ID: 1087141269

View in Genome Browser
Species Human (GRCh38)
Location 11:94768254-94768276
Sequence GCCGGGCGCCACGGCGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087141253_1087141269 25 Left 1087141253 11:94768206-94768228 CCCGGGGAGGGGCGGCGGGTGTC 0: 1
1: 0
2: 2
3: 36
4: 307
Right 1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 414
1087141254_1087141269 24 Left 1087141254 11:94768207-94768229 CCGGGGAGGGGCGGCGGGTGTCT 0: 1
1: 0
2: 3
3: 32
4: 287
Right 1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087141269 Original CRISPR GCCGGGCGCCACGGCGGGGG TGG Intronic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900135714 1:1116142-1116164 GCCTGGCGCCGGGGCCGGGGCGG - Intronic
900432890 1:2611365-2611387 ACCGGGAGCCACGGAGAGGGTGG + Intronic
900607869 1:3531802-3531824 GCCGGGCCGCGGGGCGGGGGAGG + Intronic
900658765 1:3772724-3772746 GCAGGGGGCGAGGGCGGGGGCGG - Intergenic
901109858 1:6785695-6785717 GGCGGGCGACCCGGCCGGGGAGG + Intronic
901526018 1:9823870-9823892 GCCCAGCGTCACGGCGGCGGCGG - Exonic
901597901 1:10399428-10399450 GCCGGGCGCGAGGGCGGGGCTGG + Intronic
902214117 1:14924033-14924055 TCTGGGCGCCGCGGCGGGGCGGG + Intronic
902237720 1:15068406-15068428 GCAGGGTGCCAGGTCGGGGGTGG - Intronic
902323569 1:15684304-15684326 GCTGTGCGCCGCGGCGGCGGCGG - Intergenic
902585736 1:17437959-17437981 GCCCGGGCCCGCGGCGGGGGAGG - Intronic
902771281 1:18646878-18646900 GCGGGGCGGCGCGGCGCGGGGGG + Intronic
904211221 1:28887772-28887794 GGCTGGCGCGACGGCCGGGGGGG - Intronic
904253112 1:29238358-29238380 GCCGGTGGCGAGGGCGGGGGAGG - Intronic
904672890 1:32179598-32179620 GGCGGGCGCCCCGGCAGGGCGGG - Intergenic
904724920 1:32539784-32539806 GCCGGGCGGCGAGGCGGGCGCGG - Intronic
905179153 1:36156011-36156033 GCGGGGCTCCGGGGCGGGGGCGG + Intronic
905449289 1:38046650-38046672 CCCGGACGCCGCGGCGGCGGCGG - Exonic
905863861 1:41366448-41366470 GCTGGGCACGGCGGCGGGGGAGG - Intronic
906157439 1:43622025-43622047 CCGGAGCCCCACGGCGGGGGTGG - Exonic
906293019 1:44632085-44632107 GCCGGAGGCCAGGGCTGGGGCGG + Intronic
906772600 1:48498651-48498673 GCAGGACGCCACGGCAGGAGGGG - Intergenic
908473920 1:64470526-64470548 GCGGGGCTCCGCGGCGGTGGGGG - Intergenic
908703277 1:66924820-66924842 GCCGGGCGTCATGGCGACGGTGG + Exonic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
912878955 1:113390407-113390429 GCCGGGCGCCGCGCGGCGGGAGG + Intergenic
914263569 1:146019431-146019453 GCGGGGCCCCGGGGCGGGGGAGG + Exonic
914373381 1:147050770-147050792 GCCGGGTACCAGGCCGGGGGAGG + Intergenic
914889770 1:151612292-151612314 GCCGGGAACGGCGGCGGGGGAGG + Exonic
915311029 1:155005881-155005903 GCCAGGCGCCAAGGCGGGCCCGG + Intronic
917755405 1:178093814-178093836 CCCGGCAGCCACGGCGGTGGCGG - Intergenic
917846637 1:179025868-179025890 GCCGGGGGCCTCGGAGGCGGGGG + Intronic
920878421 1:209858730-209858752 GCAGGAGCCCACGGCGGGGGTGG + Intergenic
922505647 1:226123961-226123983 GCTGGGCACCACAGCGGGGAGGG + Intergenic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1062823409 10:551281-551303 GCCAGGCTCCATGGCGGGGTGGG - Intronic
1064354243 10:14603840-14603862 GCCGGGCGCCGCGGGGCGAGGGG + Intronic
1065020213 10:21496571-21496593 CCAGGGCGACGCGGCGGGGGCGG - Intronic
1065214945 10:23439726-23439748 GCCGGGCGGGCCGGCGGCGGCGG - Exonic
1065636721 10:27742516-27742538 CCCGGGCGCCCCGCCGGGGAGGG - Intronic
1066437372 10:35406876-35406898 GCCGGCCGCCCCGACGGGGACGG - Intronic
1066464234 10:35639512-35639534 CGCGGGCGCCACGGCCGCGGGGG - Exonic
1068637399 10:59362684-59362706 GCGGGGCGCGGCGGCGGGGCTGG + Intronic
1069023995 10:63521216-63521238 GCCGGGCTCCAGGGCTGGGCTGG - Intergenic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1070079166 10:73168404-73168426 GCCGCCCGCCCCGGCTGGGGTGG - Intronic
1070367339 10:75750265-75750287 GCCAGCCGCCCCGGCGGGGAGGG - Intronic
1074101033 10:110355087-110355109 GCCAGGTGCCAAGGGGGGGGGGG + Intergenic
1074377422 10:112951373-112951395 GCCGGGCGCCCCGACCGGGCCGG - Intronic
1075022233 10:118960407-118960429 GCCTGGGGCCAGGGCGGGGAGGG - Intergenic
1075040532 10:119104055-119104077 GGCGGGCCCTACGGCGGGCGGGG + Intergenic
1076750103 10:132538087-132538109 CCCGGGCACCATGGCGGGGAAGG + Exonic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1076876521 10:133218964-133218986 CTCGGGCCCCAAGGCGGGGGTGG + Intronic
1076885893 10:133262117-133262139 GCCGGGAGACGGGGCGGGGGCGG + Intergenic
1077386464 11:2271591-2271613 GGAGGGAGCCACGGTGGGGGAGG - Intergenic
1077404653 11:2377627-2377649 GCCGGGGGCCGGGGCGGGAGGGG + Intronic
1080037312 11:27722675-27722697 GGCGGGAGCCAGGGCTGGGGTGG + Intergenic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1082022475 11:47546262-47546284 GCCGGGGGCGGGGGCGGGGGAGG + Intronic
1083660025 11:64247576-64247598 GCCTGGCCGCAGGGCGGGGGAGG - Intergenic
1083747717 11:64744871-64744893 GCCTGGCGCGGGGGCGGGGGCGG - Intronic
1083747768 11:64745004-64745026 CCCGGGCGGCGCGGCAGGGGAGG - Intronic
1083886211 11:65574580-65574602 GCAAGGGGCCCCGGCGGGGGCGG + Intergenic
1083933614 11:65859262-65859284 GCCGGGAGTCCGGGCGGGGGCGG - Exonic
1084112537 11:67023335-67023357 GCCCGGCGACACTGCAGGGGTGG + Intronic
1084295911 11:68213387-68213409 GGGGGGCGCGACGGCGGCGGCGG - Exonic
1084385804 11:68841978-68842000 GCCCGGGGCCTCGGCGGGGCGGG + Intronic
1084461185 11:69297553-69297575 GCCAGGCGCCAGGGCTGCGGCGG - Intronic
1084833626 11:71787526-71787548 CTCGGGCGCCATGACGGGGGCGG - Exonic
1085474907 11:76783507-76783529 GCCGGGCGCAGGGGCGGGGCTGG + Intronic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1087348427 11:97000662-97000684 GCGGGGCGCCCCAGCAGGGGTGG + Intergenic
1087761806 11:102110648-102110670 GCCGGGGCGCAGGGCGGGGGCGG + Exonic
1088764384 11:112962006-112962028 GGCGGGCGGCGGGGCGGGGGAGG + Intronic
1089046105 11:115503559-115503581 GCCCGGCCCCGCGGGGGGGGCGG - Intronic
1090780353 11:130002127-130002149 GCCGGGCGCCGGGCTGGGGGTGG - Intronic
1091178088 11:133579613-133579635 GCCGGGAGCCAGGGTGGGCGAGG - Intergenic
1091206421 11:133824427-133824449 GCCAGGCCCCACGGCTGGTGAGG + Intergenic
1091225743 11:133955902-133955924 GCTGGGGGCGGCGGCGGGGGAGG - Intronic
1091915513 12:4269903-4269925 GCCCAGCGCCCCGGCGGGCGCGG + Intergenic
1092094246 12:5828267-5828289 GCCGGGCTCCAGGCTGGGGGAGG - Intronic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1094494236 12:30979501-30979523 GCCCGGTGCCAGGGCAGGGGTGG + Intronic
1096659511 12:53115560-53115582 GCAGAGCACCACGGCGTGGGCGG - Exonic
1096675064 12:53221750-53221772 GCCGGGCGGCCCGGCGGCTGAGG - Intronic
1096747853 12:53739951-53739973 GCCGAGGGCGAGGGCGGGGGCGG + Intergenic
1096747866 12:53739976-53739998 GCCGAGGGCGAGGGCGGGGGCGG + Intergenic
1098683111 12:73382866-73382888 GGCGGGCGGCATGGGGGGGGCGG - Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101914407 12:108885134-108885156 GCCGGCAGCCACGTCGGTGGTGG - Exonic
1103363860 12:120368912-120368934 GCCGGGCGCCAGGGCGCAGGGGG + Intronic
1103649640 12:122422636-122422658 GCCCGGCCCCGCGGCGGCGGCGG - Intergenic
1104854350 12:131894991-131895013 GCCGGGCTCCATGGCGCAGGCGG - Exonic
1104961479 12:132490331-132490353 GCTGGGCGCATCGGCGGGGGCGG - Exonic
1106248768 13:27968722-27968744 GCCGTGAGCCACGGCGTTGGCGG + Exonic
1106517119 13:30465265-30465287 GCGGGGCGCCGCGGCGGGCGAGG - Intronic
1106956335 13:34942691-34942713 GCCCGGCGCCGCGGCGCTGGTGG + Exonic
1107133437 13:36920065-36920087 CCGGGGGACCACGGCGGGGGCGG - Intronic
1108521617 13:51251618-51251640 GGCGGGCGTCCCGGCGGCGGCGG + Exonic
1110119609 13:71865797-71865819 GCCGCGCGCCCCGGCGAGCGCGG - Intronic
1110450725 13:75635904-75635926 GCCGCGCTCCCCAGCGGGGGAGG + Intronic
1113376457 13:109768832-109768854 GCCAGGCTCAACGGCGGGGCAGG + Intronic
1113852559 13:113426219-113426241 TCCTGGCTCCACGGCGGGGAAGG - Intronic
1113906314 13:113820873-113820895 GGCGGGCTCCACGGGGGGGCAGG + Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1116928702 14:50668394-50668416 GCCTGGAGCCGCGGTGGGGGAGG - Intergenic
1118137405 14:63045207-63045229 GCCAGGATCCGCGGCGGGGGAGG + Exonic
1118220968 14:63853767-63853789 GCCTAGCGCCTCCGCGGGGGCGG + Intronic
1119004121 14:70908304-70908326 GCGGGGGGCCCCGGCGGGGACGG - Intronic
1119004159 14:70908430-70908452 GACGAGGGCCGCGGCGGGGGCGG - Intronic
1120953351 14:90061714-90061736 GCGGGGCGGGGCGGCGGGGGGGG - Intergenic
1121369933 14:93347443-93347465 GCGGGGCGCCCCGACGGGTGGGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122436687 14:101705923-101705945 GCCGGGCTCCAGGGAGGGCGAGG - Intergenic
1122688929 14:103522575-103522597 GCCGGGGGGCCCGGCGGCGGGGG - Intronic
1122689007 14:103522764-103522786 ACCGGGCGGCCGGGCGGGGGCGG + Exonic
1122891204 14:104733086-104733108 GCCAGGCGCCAAGGCAGGGTGGG - Intronic
1122905696 14:104800596-104800618 GCAGCGCGCCCCGGCGGGGAGGG - Intronic
1122947842 14:105021292-105021314 GCCGGGCGCAGGGGCGGGGGCGG - Intergenic
1123037996 14:105479081-105479103 GCCGAGCCCCGGGGCGGGGGCGG - Intronic
1123898065 15:24848235-24848257 GGCGGGGGCGGCGGCGGGGGCGG + Intronic
1124129524 15:26971626-26971648 GCTGGGCGACAGGGCGGCGGGGG + Intronic
1124392182 15:29269466-29269488 CCTGGGCCCCACGGCGGGGGCGG + Exonic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124477040 15:30044592-30044614 GCCGGGCCTGGCGGCGGGGGGGG - Intergenic
1124940019 15:34209772-34209794 GCGGGGCGGCAAGGCCGGGGCGG - Intronic
1124957227 15:34367322-34367344 TGCGGGCGCCGCGGCGGGCGCGG - Intergenic
1126837258 15:52679450-52679472 ACCGGGCGCCAGGGCCGCGGAGG - Intronic
1127606487 15:60592359-60592381 CCCGGGCGCCCCGCCGGGGCCGG - Intronic
1128321994 15:66701083-66701105 GCGGGGCGCCGCGCCGGGGGTGG + Intergenic
1129162113 15:73752850-73752872 GCCGGGGGCCCCGGCCGGGCTGG + Intergenic
1129288003 15:74541221-74541243 GCCGGGGGCCACAGCCGGGGCGG - Exonic
1130040930 15:80404620-80404642 GCCGGGCGCCCCCGGGGGCGCGG + Intronic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1131701562 15:94942662-94942684 GGAGGGCGGCAGGGCGGGGGCGG - Intergenic
1132365154 15:101251655-101251677 GCAGGCCGCGGCGGCGGGGGCGG - Exonic
1132556116 16:573384-573406 GCCGGGTGCCACCGTGGGCGGGG + Intronic
1132580862 16:684121-684143 GCCGGGGGCCGTGGCGGAGGAGG - Exonic
1132604650 16:788622-788644 GCAGTGCGCGACGGCGGCGGCGG + Exonic
1132663934 16:1073188-1073210 GACGGGGGCCACAGCGGGGCTGG + Intergenic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1133008861 16:2899115-2899137 GCCGGGCGCCACAGAGCAGGGGG - Exonic
1133213100 16:4273774-4273796 GCCGGGGGCCCCGGCAGGGAGGG + Intergenic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1133304478 16:4800917-4800939 GCCAGGCACCAAGGCGTGGGGGG - Intronic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1135135533 16:19883875-19883897 GCCCGGGGCCAAGGCGGGTGCGG + Intronic
1135135820 16:19884917-19884939 GCCGGGGGCGGGGGCGGGGGCGG - Exonic
1136003562 16:27313833-27313855 GCCGGGCGCGCCGGGCGGGGCGG + Intronic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136488022 16:30585583-30585605 GCCGGGCGCGGCGCCAGGGGCGG + Exonic
1136518840 16:30783889-30783911 GCAGGGCCGCCCGGCGGGGGCGG - Exonic
1136539754 16:30922829-30922851 GCCGTGCGCCACTGGTGGGGGGG + Intergenic
1136622883 16:31442125-31442147 GCCGGCCGCAAAGGCGGTGGAGG + Intronic
1138179352 16:54931488-54931510 GCCGGGCGGGAGGACGGGGGCGG + Intronic
1138251206 16:55503119-55503141 GCCTGGAGCCAGGGCAGGGGAGG + Intronic
1138360748 16:56425438-56425460 GCCCGGCGCGGCGGCGGCGGCGG - Exonic
1138507747 16:57486538-57486560 GCCGGCCGCCAGGGCGGGGCAGG - Intronic
1138597320 16:58035916-58035938 GCCGGGTGCCAGGGCTGGGCTGG + Intronic
1138704275 16:58898389-58898411 GCCGGGGGCCAGGGGGGCGGTGG - Intergenic
1140927654 16:79599405-79599427 GGCGGACACCACGGCGGCGGCGG + Exonic
1141132333 16:81444896-81444918 GGCGGGCGCCGGGGTGGGGGCGG - Intergenic
1141164468 16:81651259-81651281 GGCGGGAGCCCGGGCGGGGGTGG + Intronic
1141493413 16:84390231-84390253 GGAGGGCGCCACAGCGGGGCTGG + Intronic
1141516692 16:84549547-84549569 GCCGGGGGCCAGGGAGGGGGTGG + Intronic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1142179771 16:88662771-88662793 GCCGGGCGACCCTGCAGGGGCGG + Intronic
1142403771 16:89874357-89874379 GCCTGGGGCCACCGTGGGGGTGG + Intronic
1142491780 17:284362-284384 GCCTGGCACCAGGGCAGGGGAGG - Intronic
1142694835 17:1628019-1628041 ACCGGCCGCCGCGGCCGGGGAGG - Intronic
1142852693 17:2711810-2711832 GCCGGGCGCGAGGGTGGGGCAGG - Intronic
1143016376 17:3893093-3893115 GCCGGGCGCGGCGGTGGGCGGGG - Intronic
1143452120 17:7042542-7042564 GCAGGGCGCCACAGGGGGTGAGG + Exonic
1143565340 17:7717372-7717394 GCCGGGCGCCAGGCCGGCGAGGG - Exonic
1143783190 17:9240092-9240114 GCGGGGCCGCACGGCGCGGGGGG + Exonic
1144391082 17:14793943-14793965 GCCGGCAGCCACTGCGCGGGGGG + Intergenic
1144775663 17:17783397-17783419 GCCGGGAAACAAGGCGGGGGCGG + Intronic
1146057762 17:29589619-29589641 GCCGGGAGCCGCGCAGGGGGCGG - Intronic
1146339566 17:32007541-32007563 GCCGGGCGCAGTGGCGGCGGTGG - Intergenic
1146371062 17:32265915-32265937 GCCGGGCGCGAGGGCCGGGGCGG + Intergenic
1146382587 17:32341931-32341953 GCCGGGCGGCGGGCCGGGGGCGG + Intronic
1147123711 17:38351959-38351981 TCCGGGGGCCGCGGCGGGCGGGG + Intergenic
1147393252 17:40122574-40122596 GCCGGGCACCGAGGCGGAGGAGG - Intronic
1147672389 17:42184172-42184194 TCCGGGCGCGACGGAGGCGGCGG + Exonic
1147907593 17:43833047-43833069 GCTGGGCGCCGCGGCGGGAGGGG - Intronic
1148095681 17:45051496-45051518 GCCGGGCGCCGGGGAGGGGGCGG - Intronic
1148549411 17:48541806-48541828 GCCGGGCGGCGGGCCGGGGGGGG - Intronic
1148553507 17:48564427-48564449 GCCGGGGGCGGGGGCGGGGGCGG - Intronic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148906741 17:50917233-50917255 GCGGGGGGCCAGGGCGGGGCGGG - Intergenic
1149989934 17:61377333-61377355 GCCGGTGGCCTCGGCAGGGGTGG + Intronic
1151866466 17:76806395-76806417 GCAGGAGCCCACGGCGGGGGCGG - Intergenic
1151938869 17:77280942-77280964 GCCGGGCACCGCGGCGGCGCCGG - Intronic
1152197333 17:78925301-78925323 GCCGGGCGGGGCGGCGGGGTGGG + Exonic
1152238070 17:79148769-79148791 GCAGGGAGCCCCGGCGGGGTCGG - Intronic
1152360743 17:79832107-79832129 GCGGGGCGCCAGGGCGGAAGAGG - Intergenic
1152362559 17:79839398-79839420 GCCGGGAGCCGGGGCGGGCGCGG - Exonic
1152625663 17:81386950-81386972 GCGGGGCGCGGCGGCGAGGGTGG + Intergenic
1152654876 17:81514816-81514838 GCCGGGCTTCCCGGCGGAGGCGG - Intronic
1152756794 17:82090375-82090397 GCCGGGCGCCATGGCAGCCGTGG - Exonic
1152870637 17:82751579-82751601 GCCGGGGGGCGGGGCGGGGGCGG - Intergenic
1155096291 18:22559516-22559538 GCCAGGCGGCCCGGCCGGGGAGG - Intergenic
1155691015 18:28622538-28622560 GCCGGGCGTGGCGGCGGGCGCGG - Intergenic
1156275774 18:35581662-35581684 GCCGGGCGCGGAGGCGGGGGCGG + Intronic
1156411129 18:36829026-36829048 GCCGGCCGCGCAGGCGGGGGCGG + Intronic
1157383815 18:47246659-47246681 GCCAGGGGCGGCGGCGGGGGCGG + Intronic
1157706800 18:49813963-49813985 GCGGGGCGCGGCGGCGGCGGCGG + Intronic
1158434690 18:57427847-57427869 CGCGGGCGCCAGGCCGGGGGCGG + Intergenic
1158435998 18:57435837-57435859 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1159460246 18:68714777-68714799 GCAGGGTGGCGCGGCGGGGGCGG + Intronic
1160497718 18:79384923-79384945 GCCGGGAGCAAGGGTGGGGGTGG - Intergenic
1160725022 19:614042-614064 GGCGGGTGCCCTGGCGGGGGAGG + Intronic
1160812981 19:1020941-1020963 CCCGGGCCCAACGGCGGCGGCGG - Exonic
1160817222 19:1041761-1041783 GCCGGGCGACCCGATGGGGGTGG + Intronic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160908800 19:1465415-1465437 GCCTGGGGACACGGCGGTGGCGG - Exonic
1160967782 19:1754122-1754144 GCCAGACGCTGCGGCGGGGGTGG - Exonic
1160968916 19:1758777-1758799 GGCGGGCTCCTCGGCGGGGGTGG + Intronic
1161076860 19:2290033-2290055 GCCGGCCGCCGCGGCGGGCCAGG - Exonic
1161076994 19:2290616-2290638 GCCGCGCACCTCGGCCGGGGTGG + Exonic
1161400655 19:4065355-4065377 GCCGCGCGCTGCGGCCGGGGCGG - Intronic
1162397318 19:10424577-10424599 ACCGGGCGCCGCGACGGTGGCGG - Intronic
1162470923 19:10871657-10871679 CCCGGGCGCAGCGGCGGCGGCGG + Exonic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163320567 19:16572324-16572346 GGCGCGGGCCACGGCGCGGGGGG - Exonic
1163464012 19:17455684-17455706 GGCGGGCGCGACCCCGGGGGAGG - Exonic
1163617928 19:18340749-18340771 GCCGGGGGCAGAGGCGGGGGCGG + Intronic
1163635068 19:18433837-18433859 GCCCGACGCCGCCGCGGGGGGGG - Intronic
1164558290 19:29269937-29269959 GCTGGCAGCCACAGCGGGGGGGG - Intergenic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1166547045 19:43639893-43639915 GCGGGGCGCCGAGGCCGGGGCGG + Intergenic
1166765690 19:45251358-45251380 CCCGGGCGCCATGGGGGCGGCGG - Exonic
1166807698 19:45496985-45497007 GCCGAGCACCAGGGCGGCGGCGG - Exonic
1166853414 19:45770928-45770950 GCGGGGCGCGACGGCGGAGGGGG + Intronic
1167428953 19:49443353-49443375 GGCGGGCGCCAAGGACGGGGTGG + Intergenic
1167606192 19:50482203-50482225 ACCGGGGGCCAGGGTGGGGGTGG + Exonic
1168064039 19:53909381-53909403 GCCGGGCTCCGGGGCGGGGGCGG + Exonic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
925609818 2:5693246-5693268 CGCGGGCGCCAAGGCGGGCGCGG + Exonic
926154972 2:10448541-10448563 GCGGGGCGCGAAGCCGGGGGCGG - Intergenic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
927751455 2:25673712-25673734 GCGGGGCGCGGCCGCGGGGGCGG - Intergenic
928106071 2:28471399-28471421 GGCGGGAGCCAGGGCGGGGGAGG + Intronic
928186419 2:29115262-29115284 GCCTGGCTTCGCGGCGGGGGAGG + Intronic
928303524 2:30147321-30147343 GCCCGGCTGCGCGGCGGGGGCGG - Intronic
928511774 2:32010091-32010113 GCCCGGCCCCGCGGCGGCGGCGG - Intronic
929033712 2:37671806-37671828 GCCGGGCGCGCGCGCGGGGGGGG + Exonic
929133731 2:38602998-38603020 GACGGCCGCGAAGGCGGGGGCGG - Intronic
929737710 2:44568048-44568070 GCCAGGGGCCAGGGTGGGGGTGG + Intronic
929787340 2:45002115-45002137 GCGGGGCGCCGGGGTGGGGGTGG + Intergenic
930156417 2:48111736-48111758 GCCGGGGGCGCCGGCCGGGGAGG - Intergenic
932765210 2:74464969-74464991 GTCCGGGGCCACGGCGGGGCTGG + Exonic
934705012 2:96471001-96471023 CCCAGGGGCCACGGCGGGGTTGG + Intergenic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935971485 2:108534368-108534390 GCCGCGCGGGAAGGCGGGGGAGG - Intronic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936935687 2:117836512-117836534 CCCGGACGCCACGGTGAGGGAGG + Intergenic
938368840 2:130756263-130756285 GCCGCGCGCCGCGGCCGGGAGGG - Intronic
941666188 2:168246615-168246637 GCCGGGCTGCAAGGCGGGCGTGG + Intronic
941666321 2:168247172-168247194 GCCGGGCGCCGAGGCCGGGCGGG - Intronic
946063021 2:216961094-216961116 GCCAGGGGCCAGGGCTGGGGCGG + Intergenic
946196153 2:218033979-218034001 GCCTGGCGCCCCGGCGGGCAGGG + Intergenic
946929200 2:224655634-224655656 ACCGGGCGCCACGGAGCAGGGGG - Intergenic
947549751 2:231037760-231037782 GCCGGGCGGCGCGGCGGCAGAGG + Exonic
947593079 2:231395969-231395991 GGCGGGCGCGGCGGCGGCGGCGG + Intronic
948645186 2:239400340-239400362 GCCGGGAGTGAGGGCGGGGGCGG - Intronic
948687403 2:239677701-239677723 GCCGGGCCCCAGGGCTGGTGTGG - Intergenic
948824776 2:240568870-240568892 GCAGGGCGTCTCGGCGGCGGCGG - Exonic
948824806 2:240568945-240568967 GCCGGGCGCCTCGGGGAAGGCGG - Exonic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
1168965228 20:1894688-1894710 CCCGGGCGCCGGCGCGGGGGAGG + Intronic
1169327545 20:4687249-4687271 GCCTCGGGCCTCGGCGGGGGCGG + Intronic
1171973374 20:31578601-31578623 ACCGGGCGCCATGGAGGAGGGGG + Intergenic
1173548167 20:43914869-43914891 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1173672868 20:44810284-44810306 GCCGGGCGCCTCGGCCGCGGCGG + Intronic
1174237784 20:49108277-49108299 GCCGGGCGCGGTGGCGGGCGCGG + Intergenic
1174317520 20:49713907-49713929 AGCGGGCGCAGCGGCGGGGGCGG + Intergenic
1174380712 20:50153735-50153757 GCCGGGCGCGGCGGCGGCGCGGG + Intergenic
1174576734 20:51542526-51542548 GCCGGGGGCGAGGGCGGGCGCGG + Exonic
1174804437 20:53593711-53593733 GGCGGGCGCCCCGGCTGGCGCGG + Intronic
1175439547 20:58981197-58981219 GCCGCGCGCCTCGGCCCGGGCGG - Exonic
1175813366 20:61870623-61870645 GCCGGGGGCCACGGGTGGAGGGG + Intronic
1175847062 20:62064911-62064933 GGGGGGCGGCACGGCGGGCGCGG + Exonic
1175948462 20:62569762-62569784 GACGGGAGCCACGGCAGGGGCGG - Intronic
1176084671 20:63290526-63290548 TCCTGGAGCCACGGTGGGGGTGG - Intergenic
1176178636 20:63739780-63739802 TCCGGGCGGCGCGGCGCGGGCGG + Intronic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176733542 21:10522067-10522089 GGCGGGCGCCCCGGCTGGCGCGG - Intronic
1178555761 21:33588701-33588723 GCGAGGCGCCACGTCAGGGGCGG - Exonic
1178992610 21:37367652-37367674 GCCGAGCGCCAGGCCGGGCGGGG - Intronic
1179882583 21:44299814-44299836 GCCGGGGACCAGGGCGGGGCTGG - Intergenic
1180014683 21:45074527-45074549 GCCCGGCGGGCCGGCGGGGGCGG + Intronic
1180096020 21:45555528-45555550 GCAGGGGGCGGCGGCGGGGGCGG + Intergenic
1180096095 21:45555771-45555793 GCCGGGCCCCTCGGCTGGCGCGG - Intergenic
1180914836 22:19478988-19479010 GCGGGGCGGGACGGCGGCGGAGG - Intronic
1181026822 22:20131725-20131747 GCTGGGGGCCGCGGCGGGGCGGG - Intronic
1182094070 22:27614476-27614498 GGCGGGCGCCGTGGCGGTGGCGG + Intergenic
1182260716 22:29071690-29071712 GCCTGGCGGGAGGGCGGGGGAGG + Intergenic
1182576494 22:31276623-31276645 GGCGGGCGTCACGGAGGCGGCGG + Intronic
1182663912 22:31944035-31944057 GGCGGGCGGGACGGCTGGGGCGG + Intronic
1183093733 22:35540433-35540455 GCCGGGCGCCGGGGCGAGGCGGG + Intergenic
1183358930 22:37373460-37373482 GGCGGGGGCAGCGGCGGGGGCGG - Exonic
1183535460 22:38398394-38398416 GGCGGGCGCCCCGGCTGGCGCGG + Intronic
1183961426 22:41413875-41413897 GGCGGCCGGCACGGCGGGCGCGG + Intergenic
1184101559 22:42343912-42343934 GCCGTGCGCGCCGGCGGGGGAGG + Intergenic
1184481805 22:44752548-44752570 CCCGGGAGCCACGTCCGGGGAGG + Exonic
1185037934 22:48489463-48489485 CCCGGGCGCGGCGGCGGCGGCGG + Exonic
1185055325 22:48576043-48576065 GCCGGGCGGCGCGGGGGGGGGGG - Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185285792 22:49999530-49999552 GCCGCGCGGGAGGGCGGGGGTGG + Intronic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
952889165 3:38029544-38029566 GACGGGCGGCGCGGCGGGAGGGG + Intronic
953705141 3:45225506-45225528 GGTGGGCGCCCCGGCGGTGGCGG + Exonic
954107343 3:48416393-48416415 GGCCGGCGCCACAGCGGTGGAGG - Exonic
954450241 3:50567684-50567706 GCCGGGACCCACGGCGGAGGTGG + Exonic
955060442 3:55488167-55488189 CCCGGGCACAACGGCGGCGGCGG + Intronic
961780078 3:129316044-129316066 GCCGGGCGGCAGGGCTGGGGTGG + Exonic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
968035318 3:195543405-195543427 CCCGGGCGGGACGGAGGGGGCGG - Intergenic
968235988 3:197030186-197030208 GCCGAGCGCCCTGGCGAGGGGGG + Intergenic
968236015 3:197030270-197030292 GCCGAGCGCCCTGGCGAGGGGGG + Intergenic
968236042 3:197030354-197030376 GCCGAGCGCCCTGGCGAGGGGGG + Intergenic
968236069 3:197030438-197030460 GCCGAGCGCCCTGGCGAGGGGGG + Intergenic
968446232 4:653714-653736 GCCAGGCTCCACGGCTGGGCAGG + Intronic
968640467 4:1712102-1712124 GCCGGGCTGCGCGGCGGGCGAGG - Intronic
968666814 4:1826993-1827015 GACGGGCTCCACGGTGTGGGTGG - Intronic
968850577 4:3075024-3075046 GGCGGGGGCGGCGGCGGGGGCGG - Exonic
969714283 4:8860958-8860980 GGCGGGGGCGAGGGCGGGGGAGG + Intronic
971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG + Intergenic
971457935 4:26861325-26861347 GCCGGCCGCCGCGGCGGGAGAGG - Exonic
973292330 4:48483270-48483292 ACCGGGCGGCAGGGCGGGGCGGG + Intergenic
973760453 4:54109944-54109966 TCCGGGCGCCAGGGCAGGGATGG + Intronic
973764250 4:54149338-54149360 GCCGGGCGCCGCGGAGCAGGGGG + Intronic
975160764 4:71121274-71121296 ACCGGGCGCCACGGAGCAGGGGG - Intergenic
975281740 4:72569412-72569434 CGTGGGCGCCACGGCGGGAGGGG - Intergenic
978072584 4:104491453-104491475 GGCGGGGGCGGCGGCGGGGGGGG - Exonic
978443975 4:108763119-108763141 GCCCGCGGCCCCGGCGGGGGAGG - Intergenic
978576711 4:110196768-110196790 GCCGCGCGCACCGGCGGGGCAGG - Intronic
979455477 4:120922343-120922365 ACCGCGGGGCACGGCGGGGGTGG - Intronic
979785684 4:124712798-124712820 GCCGAGCGGCGGGGCGGGGGCGG - Intergenic
985575186 5:670548-670570 GCTGGGCCCCACGGGGGGAGGGG + Intronic
985580568 5:693485-693507 GCCGGGTGGGGCGGCGGGGGCGG - Intergenic
985660741 5:1155599-1155621 GCCTGGCGGGCCGGCGGGGGTGG - Intergenic
985727542 5:1523960-1523982 GCCGGGCGCGCAGGCGCGGGAGG + Exonic
986297108 5:6448785-6448807 AGCGGGCGCCAGGGCGGGGCCGG + Exonic
986748094 5:10761384-10761406 GCCGGGGGCGGGGGCGGGGGCGG + Intergenic
987050462 5:14143751-14143773 GCCGGAGGACGCGGCGGGGGCGG - Exonic
987050471 5:14143769-14143791 GCTGGCCGCCGCGGCGGGGCCGG - Exonic
990004365 5:50928197-50928219 GCCAGGAGCCAAGGTGGGGGTGG + Intergenic
991245716 5:64506570-64506592 GCAGTGCGCCCCGGCGCGGGCGG - Exonic
991351201 5:65722134-65722156 GCCGGACGCGAGGGCTGGGGCGG + Intronic
992769698 5:80035490-80035512 GCCGGGGGCGACGGCGGCGTTGG - Exonic
992796104 5:80256144-80256166 GCCGGGCGCCCGGGAAGGGGCGG - Intergenic
993463224 5:88211612-88211634 GCCGGGCGTGGCGGCGGGCGCGG + Intronic
993901023 5:93584512-93584534 GCGGGGCGCAGCGCCGGGGGCGG - Exonic
994075646 5:95646733-95646755 GCGCGGCGCCTCGACGGGGGCGG - Intronic
995503696 5:112836172-112836194 GCCGGGCACGGTGGCGGGGGGGG - Intronic
995759129 5:115544891-115544913 GCGGGGCGTCGCGGCCGGGGTGG + Exonic
995787121 5:115841989-115842011 ACTGGGGGCCAGGGCGGGGGCGG - Exonic
997479745 5:134176475-134176497 CCCGGGGACCAGGGCGGGGGTGG - Intronic
997635182 5:135399309-135399331 GCCGGGCGGCACGGGCGCGGAGG - Exonic
998108080 5:139481275-139481297 ACAGGGCCCCACGGCGGAGGGGG + Exonic
1001191544 5:169637193-169637215 GCGGGGAGCCCCGGCGAGGGAGG + Intergenic
1004044580 6:12012111-12012133 GGCGCGCGCCGCGGCGGGGCGGG - Intronic
1004216776 6:13711237-13711259 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004690340 6:17987677-17987699 GCGGGGCGCGGCGGCGGCGGCGG + Intergenic
1005644330 6:27826785-27826807 GCCGGCCGCCCCGTCCGGGGGGG - Intergenic
1005825106 6:29627780-29627802 CCCGGGCCCCATGGCGTGGGGGG + Intronic
1006148312 6:31972176-31972198 GCCGGGCCCCACGCCGGCCGCGG - Exonic
1012400020 6:98835111-98835133 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1013619278 6:111872865-111872887 ACCGGGCCCTGCGGCGGGGGCGG + Intronic
1013619383 6:111873158-111873180 GCCGGGCGGTGCGGCGCGGGCGG + Exonic
1013793682 6:113860422-113860444 GCCGGGCCCGGCGGCGGAGGGGG - Exonic
1015976436 6:138795992-138796014 TCCGGGCGCGGCGGCGGGAGGGG + Intronic
1016162440 6:140898082-140898104 CCCGGGAGCCACGGGGGTGGGGG + Intergenic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1018391448 6:163344711-163344733 GCCTTGCGCCACGGAGGAGGTGG - Intergenic
1018900537 6:168049738-168049760 GCCGGGGGCCAGGGTGGGGGTGG + Intergenic
1019474295 7:1236613-1236635 CGCGGGCGGCACGGCGGGCGCGG - Exonic
1019516534 7:1442631-1442653 GCCTGGCGCAATGGTGGGGGAGG - Intronic
1019795342 7:3044172-3044194 GCCGGGGGTCACGGCTGGGTGGG - Intergenic
1021493894 7:21251052-21251074 GCCGGGAGGCAGGGCAGGGGTGG - Intergenic
1022628726 7:32065069-32065091 GCCGGGGGCCAGTGAGGGGGAGG + Intronic
1023881935 7:44325662-44325684 GGCGGGCGCGGCGGCGGCGGCGG - Intronic
1024920200 7:54546516-54546538 GGCGGGCGCCAGGGGTGGGGCGG - Intronic
1026477486 7:70749346-70749368 GCTGGGCGGCACGGGGAGGGGGG + Intronic
1027219838 7:76206818-76206840 GCAGGAGGCCAGGGCGGGGGCGG - Intronic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1027956074 7:84880808-84880830 GCAGGAGCCCACGGCGGGGGAGG - Intergenic
1029708322 7:102286800-102286822 GCCGGGGCTCGCGGCGGGGGCGG + Intronic
1031008377 7:116499547-116499569 TCCCTGCGCCCCGGCGGGGGAGG + Exonic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1034455407 7:151167499-151167521 CCTGGGGGCAACGGCGGGGGCGG - Exonic
1034618150 7:152436202-152436224 GCCGCGGGGCCCGGCGGGGGCGG + Intergenic
1034911670 7:155002985-155003007 GCCGGGCGCCGCGGGGGCCGGGG - Exonic
1035747837 8:1974333-1974355 GGCGGGACCCTCGGCGGGGGCGG - Intronic
1036390290 8:8318856-8318878 GGCGGGAGCCGGGGCGGGGGCGG + Exonic
1038265904 8:26039958-26039980 GCGGCGCGCCAAGGCGGGGCTGG + Intronic
1038296155 8:26292035-26292057 GGCTGGCGCCGTGGCGGGGGTGG + Intronic
1038566283 8:28622581-28622603 GCCGGGAGCCGCCGAGGGGGCGG + Intronic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1040065444 8:43140804-43140826 GCCGGGCCCCGCGGAGGCGGGGG + Intronic
1041068570 8:54104476-54104498 GCAGGAGCCCACGGCGGGGGCGG - Intergenic
1041281029 8:56211401-56211423 GGCGGGCGCAGCGGCGGGCGGGG - Intergenic
1043398952 8:79864924-79864946 GCCGGGGGGCAGGGCGGGGGGGG + Intergenic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1046770414 8:118111914-118111936 GCCGAGCGTCACGTCCGGGGGGG + Intergenic
1048981173 8:139703923-139703945 GGCGGGCGCGGCGGCGGCGGCGG + Intergenic
1049370141 8:142260469-142260491 GCCGGGGCCCACGGCCAGGGAGG + Intronic
1049707441 8:144049414-144049436 GGCGGGCGCCAGAGCGCGGGCGG - Intergenic
1049713585 8:144078719-144078741 GCCGGGCAGCATGGCGGGGCTGG + Exonic
1049752418 8:144291518-144291540 GCCGGGGACCAGGGCGGGGTCGG + Intergenic
1049767274 8:144360683-144360705 GGTGGGCACCTCGGCGGGGGTGG + Exonic
1053129132 9:35605445-35605467 GCCAGCCGGCGCGGCGGGGGCGG + Intronic
1053409142 9:37904265-37904287 GCAGGCCGCCGCGGCGGGGCAGG + Intronic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054489437 9:65762641-65762663 GGCGGGGGCCGCGGCGGTGGGGG - Intergenic
1055044437 9:71910553-71910575 GCCGGGAGCCGCAGCGCGGGAGG - Intronic
1060477943 9:123999676-123999698 GCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1060481374 9:124018433-124018455 GCAGGGGGCGGCGGCGGGGGAGG - Intronic
1060700686 9:125747189-125747211 GCCGGGCTCCGCGGCGGTGGCGG - Intergenic
1060796153 9:126514306-126514328 GGCGGGCGGCACGGTGGGAGGGG - Intergenic
1060796185 9:126514377-126514399 GCCGGGCGCCCCCGCGCGGCCGG - Intergenic
1061262661 9:129488607-129488629 GCCGGCCGCGAGGGCGGGAGGGG - Intergenic
1061281037 9:129597692-129597714 GCCGCGCCGCAGGGCGGGGGAGG + Intergenic
1061840545 9:133356441-133356463 GCCGGGTGCGATGGCGGCGGTGG - Exonic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062209480 9:135356013-135356035 GCCGGGGGCTCCGGCTGGGGAGG - Intergenic
1062272121 9:135714433-135714455 GGCGGGCGGCCGGGCGGGGGCGG - Intronic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1062565710 9:137163088-137163110 GCCGGGCACCCCGGAGGGCGCGG + Intronic
1062609578 9:137368033-137368055 GCCAGGCAGCACGGCGGGTGAGG + Intronic
1062628471 9:137453435-137453457 GCCGGGCGCCTGGGAGGGAGTGG + Intronic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1186426070 X:9465133-9465155 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1186786024 X:12956434-12956456 GCCTGGTGCCCCGGCAGGGGAGG - Intergenic
1189335730 X:40169811-40169833 GCCGGGAGCCAGGGCGGGGACGG + Intronic
1190305590 X:49079855-49079877 GCCGGGCTCCAAGGCCCGGGAGG - Exonic
1199772772 X:150984524-150984546 GCCGGGGGCGGCGGCGGTGGCGG - Intronic
1200155579 X:153972933-153972955 CCCGGGCGCGGCGGCGGCGGCGG + Intronic
1200218523 X:154379394-154379416 GCCGAGGAGCACGGCGGGGGCGG - Exonic