ID: 1087141728

View in Genome Browser
Species Human (GRCh38)
Location 11:94770598-94770620
Sequence CATTTTAAAAAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 674}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087141728_1087141737 20 Left 1087141728 11:94770598-94770620 CCCTCCCCCTTCTTTTTAAAATG 0: 1
1: 0
2: 7
3: 64
4: 674
Right 1087141737 11:94770641-94770663 AGGTTCTTTGCAGATGATGGAGG 0: 1
1: 0
2: 1
3: 12
4: 199
1087141728_1087141734 -9 Left 1087141728 11:94770598-94770620 CCCTCCCCCTTCTTTTTAAAATG 0: 1
1: 0
2: 7
3: 64
4: 674
Right 1087141734 11:94770612-94770634 TTTAAAATGCACAGAAGTCTTGG 0: 1
1: 0
2: 4
3: 40
4: 453
1087141728_1087141735 0 Left 1087141728 11:94770598-94770620 CCCTCCCCCTTCTTTTTAAAATG 0: 1
1: 0
2: 7
3: 64
4: 674
Right 1087141735 11:94770621-94770643 CACAGAAGTCTTGGTCTTTCAGG 0: 1
1: 0
2: 0
3: 24
4: 221
1087141728_1087141736 17 Left 1087141728 11:94770598-94770620 CCCTCCCCCTTCTTTTTAAAATG 0: 1
1: 0
2: 7
3: 64
4: 674
Right 1087141736 11:94770638-94770660 TTCAGGTTCTTTGCAGATGATGG 0: 1
1: 0
2: 0
3: 23
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087141728 Original CRISPR CATTTTAAAAAGAAGGGGGA GGG (reversed) Intronic
900497667 1:2983419-2983441 CATTTTACCATGCAGGGGGATGG - Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901460404 1:9387780-9387802 CATTTGAAAATGATGGGGGCCGG + Intergenic
901533079 1:9865788-9865810 CATTTTAAAAAACTGGGGAAAGG - Intronic
902747157 1:18481798-18481820 CATTTCATACAGAAGGCGGAGGG + Exonic
903041150 1:20531660-20531682 TTTTTTAAAAAGAAGGCAGATGG + Intergenic
903428157 1:23270239-23270261 CAATTAAAAATAAAGGGGGAGGG + Intergenic
903481325 1:23655420-23655442 TATGTTAAAAAGAAGGGGAGAGG - Intergenic
904024754 1:27495669-27495691 CATTTTACAAATGAGGGGAAAGG + Intergenic
904213299 1:28899778-28899800 GATTTAAAAAAGGAAGGGGATGG + Intronic
904377853 1:30093021-30093043 CATTTTAAAAAGAATGGCTAAGG + Intergenic
904444958 1:30563377-30563399 CATTTGAAACAGAAAAGGGAGGG + Intergenic
905050084 1:35043213-35043235 AATTTTTAAAAGAGGTGGGAAGG + Intergenic
905376395 1:37524084-37524106 CATTTGAAAAAAATGGGAGATGG - Intergenic
906061146 1:42949461-42949483 CTTTTAAAAAAGAAGAGTGATGG + Intronic
906166015 1:43686786-43686808 TTTTTTTAAAAGTAGGGGGAGGG - Intronic
906275513 1:44512478-44512500 GGTTTCAAAAAGAATGGGGACGG + Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
907052293 1:51337721-51337743 AATTTTAAATAGAAAGGGGCTGG - Intronic
907421578 1:54351274-54351296 CATTTTGAAAAGTAGGAGGAAGG - Intronic
908137779 1:61150848-61150870 CATATTAGTAAGAATGGGGAGGG + Intronic
908166272 1:61462396-61462418 CATTTCAAATTGTAGGGGGAGGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908754230 1:67453347-67453369 ATTTTGAAAAAGAAGGGTGATGG + Intergenic
908782150 1:67700500-67700522 AGTTTTTAAAAGATGGGGGAAGG - Intergenic
908797948 1:67850172-67850194 AATTTTAAAAACAAAGGGAAGGG - Intergenic
908804753 1:67918606-67918628 CATTTAAAAAAGGGGAGGGAAGG + Intergenic
908850071 1:68366970-68366992 CATTTTAAAAAGAAATAGAACGG - Intergenic
909612141 1:77562576-77562598 CAATTTAAACAAAAAGGGGAAGG + Intronic
909966959 1:81924954-81924976 CATTTTTAAATTAAGGGAGAAGG + Intronic
910507453 1:87966310-87966332 CTCCTTAAAAAGAAGGGGGCGGG - Intergenic
911415484 1:97566696-97566718 CATATCAAAAATAAAGGGGAAGG - Intronic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
911478088 1:98398624-98398646 AATTTTAAAAAGAGAAGGGATGG + Intergenic
912019540 1:105089981-105090003 AATTTTAAAACCAAAGGGGAAGG + Intergenic
912080292 1:105927868-105927890 CATGTTACAAAGAAGGAAGAAGG - Intergenic
912563023 1:110563831-110563853 CATTTATAAAGGAAGGGGGCTGG - Intergenic
912780140 1:112538740-112538762 CCTTTAAACAAGAAGGGGGTAGG + Intronic
913179972 1:116311737-116311759 CACTTTAAAAAGAGAGGAGAAGG - Intergenic
913280593 1:117181607-117181629 CATTTAAAAAAGAGAAGGGAGGG - Intronic
913592128 1:120340588-120340610 GGTTTTAAATAGCAGGGGGAGGG - Intergenic
913651228 1:120914558-120914580 GGTTTTAAATAGCAGGGGGAGGG + Intergenic
914169881 1:145214509-145214531 GGTTTTAAATAGCAGGGGGAGGG - Intergenic
914251249 1:145923616-145923638 CAATTTAACAAAAAGGGGGAGGG + Intergenic
914524999 1:148458473-148458495 GGTTTTAAATAGCAGGGGGAGGG - Intergenic
914598676 1:149177358-149177380 GGTTTTAAATAGCAGGGGGAGGG + Intergenic
914918906 1:151834446-151834468 CTTTGTGACAAGAAGGGGGAGGG - Intergenic
917327650 1:173849829-173849851 CATAATGAAAAAAAGGGGGAGGG - Intronic
917621019 1:176795959-176795981 TGTTTTAAAGAGAAGGGAGAAGG + Intronic
918134667 1:181661007-181661029 CATTTAAATTAGAAGGGGCAAGG + Intronic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
918449849 1:184647619-184647641 CAGTTTATAGAGAAGGGTGAAGG - Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919789446 1:201281154-201281176 CATCTGAAAAAGAAGGGTGATGG + Intergenic
920408323 1:205737142-205737164 GATTATAAAAAGATGGGGAATGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921744064 1:218717725-218717747 CATTTTGAAAAGAATGAGCATGG + Intergenic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
922039256 1:221880196-221880218 CATTTTACAAAGAAAGAGGCTGG + Intergenic
922389166 1:225120894-225120916 CATTTTAAAAAGAATTGCAAAGG - Intronic
923441009 1:234020506-234020528 AATTTTCAAAAAAAGGGGGAGGG - Intronic
923837487 1:237628880-237628902 CCTTGGAAAAAGAAGGGGTAGGG + Intronic
923915947 1:238505129-238505151 AATTTCAAAAAGAATGGGGGAGG + Intergenic
923958122 1:239045466-239045488 CGTTTCAAAAATAAGGGAGAGGG + Intergenic
923968879 1:239177385-239177407 CATTTTACAAAGAAAGGTGGGGG - Intergenic
924108428 1:240673138-240673160 CATTTCAAAATAATGGGGGATGG + Intergenic
924818696 1:247466473-247466495 AATTTTGGAAAGAATGGGGAGGG - Intergenic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1064174391 10:13061651-13061673 CAATTCAAAAGGAATGGGGATGG + Intronic
1064525654 10:16253927-16253949 CATTTAAAAAAAAATGGGCAAGG + Intergenic
1064550917 10:16500038-16500060 CAGTTAAAAAAAAAGGGGCAAGG - Intronic
1064652155 10:17520195-17520217 CATTTTAAAAATAAGGGTCATGG - Intergenic
1065371680 10:24993148-24993170 GTTTTTAAAAAGAAAGGGAATGG + Intronic
1067183542 10:44008055-44008077 CATTCTAAAATGAAGGGAGGAGG + Intergenic
1068342997 10:55733224-55733246 CAATTTCACAAAAAGGGGGAGGG - Intergenic
1068418311 10:56755111-56755133 CATTTTTAAAAGAAGCCAGAGGG - Intergenic
1068540516 10:58289157-58289179 TATCTTAAAAAGAAGGAGGTGGG - Exonic
1068903459 10:62297024-62297046 CATTTTACAAAGATGTGAGAAGG + Intergenic
1069313357 10:67066868-67066890 AATTTTAAAATGAAGGGTAATGG + Intronic
1069493484 10:68881926-68881948 AGATTTAAAAAAAAGGGGGAGGG - Intronic
1071179966 10:82971835-82971857 CATTTTAAAAGGAAGAAAGATGG - Intronic
1071440656 10:85689729-85689751 TATTTTTAAAAGGAGGAGGAAGG + Intronic
1071539983 10:86472866-86472888 CTTTTTAAAAAGCAGGGAGCAGG + Intronic
1071836664 10:89425057-89425079 CAATTTAAAAAGGAAAGGGAAGG + Intergenic
1071903963 10:90152390-90152412 AATTGTAAAAATAAGGGAGAAGG - Intergenic
1071931888 10:90481633-90481655 CATTTAAAAAAAAGGGGGGCAGG - Intergenic
1072344767 10:94493482-94493504 GATTTTAATAAGAAGATGGATGG + Intronic
1072348803 10:94537860-94537882 CATTTTAAAAAAAATTGGGCTGG + Intronic
1073725855 10:106229715-106229737 GATTTTTAAAAGTAGGAGGAGGG + Intergenic
1073815741 10:107204798-107204820 GATTTTAAAAAGCAGGAGTAGGG - Intergenic
1074194741 10:111173486-111173508 GATTTAAAAAAAAAGGGGGGGGG - Intergenic
1074364934 10:112850077-112850099 CATTTTATAAAGAGTTGGGAGGG + Intergenic
1074613733 10:115045205-115045227 TATTTTAAAAAGAAGGCAAAGGG + Intergenic
1075361798 10:121844258-121844280 ATTTTTAAAAATAAGGGAGAAGG + Intronic
1076386032 10:130056513-130056535 CATTTTACAGAGAAAGGGAAGGG + Intergenic
1077981074 11:7301390-7301412 CATATTAAAAAGCAGGTGGGTGG + Intronic
1078043891 11:7895321-7895343 CATTTTTAAAAGGAGGGGTTGGG + Intergenic
1078777151 11:14404064-14404086 CTATTTAAAAAGAAGAGGGCAGG - Intergenic
1078797454 11:14607039-14607061 TATGTTAAAATGAAGGAGGAAGG + Intronic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1079676753 11:23237589-23237611 CAGATTAAAAAGATGGGAGAGGG + Intergenic
1080320052 11:30997989-30998011 GAGTTTAAAAAGAAAGGGGGTGG + Intronic
1081014055 11:37854087-37854109 CATTTTAAAAAGAAGAGAAAAGG + Intergenic
1081444009 11:43112229-43112251 TGTTTTAAAAAGAAAAGGGAAGG - Intergenic
1081582488 11:44361859-44361881 CTTTTAAAAAAGAAGGGGCGGGG - Intergenic
1081971569 11:47202551-47202573 CATCCTAAAATGAAAGGGGAAGG + Intergenic
1082081459 11:48015574-48015596 AATTTTAAAAATAATGGTGAGGG + Intronic
1082219948 11:49622742-49622764 CATTTTAAAAGGCAGGTGGAAGG - Intergenic
1082756920 11:57085877-57085899 CATTTAAACAAGAAGGGCAAAGG + Intergenic
1082963403 11:58940783-58940805 TATTTTATAGAGATGGGGGAGGG - Intronic
1084551283 11:69843636-69843658 CATTTTAAAAATGAGGAGGGGGG + Intergenic
1085192716 11:74642305-74642327 CCTTTTAAAAAGAAGGGTTTTGG - Exonic
1086252237 11:84830149-84830171 AATTCTAAAATGAAGGGGTAAGG - Intronic
1086629671 11:89002049-89002071 CATTTTAAAAGGCATGTGGAAGG + Intronic
1086891946 11:92268542-92268564 ACTTTTACAAAGAATGGGGAAGG - Intergenic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1088058712 11:105618012-105618034 CATTTGAAAAAGAACAAGGAAGG + Intronic
1088364354 11:109023372-109023394 AATTTTAAAAAGATTGGGGGAGG - Intergenic
1089225987 11:116922483-116922505 TTCTTAAAAAAGAAGGGGGAAGG + Intronic
1089874099 11:121703517-121703539 CATTTTCACTAGAAAGGGGAGGG + Intergenic
1089888100 11:121849357-121849379 AATTTTAAATAGAAGAGTGAAGG - Intergenic
1090020889 11:123127416-123127438 CATTATAAAAAGAGGTGGGCTGG - Intronic
1090422267 11:126583649-126583671 CATTTTACAAAGAAGGAAGCAGG - Intronic
1090830528 11:130417836-130417858 CAATTTAGAAAGATGGGGGACGG - Intronic
1091133299 11:133165055-133165077 CATTTAAAAATTAAGGGGGAAGG + Intronic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1092701905 12:11241210-11241232 CATTTTAGATGGAAGGTGGATGG + Intergenic
1093667703 12:21834183-21834205 CATTTTAAAAAGAAATTGAATGG - Intronic
1093799870 12:23360563-23360585 AATTTGAAAAAGTTGGGGGAAGG - Intergenic
1093863610 12:24198230-24198252 AATTGTAAAAAGAAAGGAGAGGG + Intergenic
1094011158 12:25811254-25811276 AATTTTAAAAAAAAGGGGGGTGG - Intergenic
1094177074 12:27552015-27552037 CATCTTTAAAACAAGGGGGATGG + Intronic
1094751945 12:33420003-33420025 CATATTACAAAGTAAGGGGAAGG - Intronic
1095304674 12:40625748-40625770 CTCTTAAAAAGGAAGGGGGAGGG - Intergenic
1095746102 12:45660696-45660718 CATGTTATAGAAAAGGGGGAGGG - Intergenic
1095812722 12:46387520-46387542 GATTTTAAAAAGGAGATGGAAGG + Intergenic
1096625399 12:52892392-52892414 CATTACTAGAAGAAGGGGGAAGG + Intergenic
1096881814 12:54679280-54679302 CATTTTAAAATGTAAGGGAAAGG + Intergenic
1096977828 12:55709566-55709588 GATATTAAAAAGGATGGGGAGGG - Intronic
1097119716 12:56721821-56721843 CATTTCAAGAAGTAAGGGGAGGG - Intronic
1097956034 12:65486085-65486107 CATTTTAAAAAGAGAGGTTATGG - Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099165533 12:79302495-79302517 CAATTTAGAAAGAAATGGGAAGG + Intronic
1099248705 12:80225272-80225294 CATTTTAAAGAGAAGGTCAAAGG - Intronic
1099772975 12:87086843-87086865 CATTTTAAGAAGAAACAGGAAGG + Intergenic
1100412393 12:94333859-94333881 TATTTTGGAAAGAAGAGGGAGGG - Intronic
1100629363 12:96371955-96371977 CATGTTAAAAAGAGGGGGGACGG + Intronic
1101208466 12:102512766-102512788 CCTTCTAAACAGAAGGGGCAAGG + Intergenic
1101586327 12:106088923-106088945 CCTGATAAAATGAAGGGGGAAGG + Intronic
1101905713 12:108824146-108824168 CATTTTAAGAAAAGTGGGGAGGG + Intronic
1102267023 12:111494856-111494878 GAAGTAAAAAAGAAGGGGGAAGG + Intronic
1102622536 12:114207860-114207882 CATTTTAATAACAAGGGTGATGG - Intergenic
1102718413 12:114995126-114995148 TAAGTTAAAAAGAAGGGGGAAGG - Intergenic
1103279987 12:119749508-119749530 CATAATCAAGAGAAGGGGGAAGG + Intronic
1103563165 12:121803249-121803271 CCTTTAATAAAGAAAGGGGAAGG + Intronic
1103994380 12:124819682-124819704 CATGTTCAAAAGAGGGTGGAAGG - Intronic
1104190739 12:126479918-126479940 CAATTTAAGAGGAAGGGGGTCGG - Intergenic
1104389004 12:128375544-128375566 CCTTATAAAAAGAAAGGAGAGGG - Intronic
1104404546 12:128506641-128506663 CATTTTCAGAGGAAGGGAGACGG - Intronic
1104617240 12:130281132-130281154 CCTTTAAAAAATAAAGGGGAGGG + Intergenic
1104643774 12:130483466-130483488 CTTTTTATAAACAAAGGGGATGG + Intronic
1104654734 12:130565663-130565685 AATTTTAAAAAGAGGGGACAAGG - Intronic
1104659237 12:130597844-130597866 AATTTTAAATAGAAGTGGTAAGG - Intronic
1105730945 13:23214722-23214744 CATTTGAAAAACAAATGGGATGG - Intronic
1106034123 13:26028499-26028521 CAGTTTTAAAAGTTGGGGGAAGG - Intergenic
1106046889 13:26151036-26151058 CATGTTAAATAAAAAGGGGAAGG + Intronic
1106643737 13:31611300-31611322 AATATTAAAAAGAAGTGGTAGGG + Intergenic
1106776260 13:33012977-33012999 AATTTTAAAAAGAGGAGGGCAGG + Intergenic
1107846665 13:44521371-44521393 TAATTTAAAAAAAAGGGGGAAGG - Intronic
1108209162 13:48120933-48120955 AATTTTAAAAAGGCAGGGGATGG + Intergenic
1108453171 13:50587561-50587583 TCTTTTTAAATGAAGGGGGATGG - Intronic
1108565174 13:51689617-51689639 TATTTTAAAAAGTTGGGGGAAGG - Intronic
1109036962 13:57275806-57275828 TAATTTAAAAAGAAGGGAAAGGG - Intergenic
1109096660 13:58127573-58127595 CAATGTAAAATGGAGGGGGAAGG - Intergenic
1109278412 13:60327665-60327687 CATTTTGAGAAGAAGGGATACGG - Intergenic
1109332894 13:60952314-60952336 GCTTTTAAAAAAAAGGAGGAGGG - Intergenic
1109861215 13:68201427-68201449 CATCTAAAAAAAAAGGGGGGGGG + Intergenic
1109873196 13:68364465-68364487 CTTTTTCAAAAGAAGGGTAAGGG - Intergenic
1111343517 13:86918932-86918954 CATATTAAAAAGATTAGGGACGG - Intergenic
1111384227 13:87502418-87502440 CATTTTAAAAAAAAATGGCATGG - Intergenic
1111930039 13:94503370-94503392 CATTTCAAAAAAAGGAGGGAAGG + Intergenic
1112383305 13:98914445-98914467 CATTTGAAACAGGAGGAGGAAGG + Intronic
1113016934 13:105838283-105838305 CATTTTAAAAAGCGGGAGGGAGG + Intergenic
1113424318 13:110195426-110195448 CATTTGTAAAATAAGGGTGATGG - Intronic
1113429766 13:110240033-110240055 CATTTTAACAAAAATGGAGAAGG - Intronic
1113468283 13:110527149-110527171 CATTTCAGAAAGATTGGGGATGG - Intronic
1114629279 14:24148781-24148803 CATCTGAAAAAGAAAGGGCAGGG - Exonic
1116434352 14:44879594-44879616 AAAGTTAAAAAGCAGGGGGAGGG + Intergenic
1116479971 14:45385622-45385644 CCTTTCCAAAAGAAGGGAGATGG + Intergenic
1116785725 14:49286510-49286532 CATTTTCAAAAGAAAAGGCAGGG + Intergenic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1117052756 14:51878283-51878305 CATTTTAAAATGGTGGGGGAGGG - Intronic
1118100511 14:62595835-62595857 CATTAAAAAAAAAAGAGGGAAGG - Intergenic
1118679725 14:68227644-68227666 CAATTTAAAAAGACCTGGGAGGG - Intronic
1118857009 14:69631279-69631301 CATTATAAAAAGAGATGGGAAGG - Intronic
1119153476 14:72387245-72387267 CCTTATAAAAAAAAGGGAGAGGG + Intronic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120323044 14:82990280-82990302 CTTTTAAAAAAGAAAGGTGATGG - Intergenic
1120394241 14:83947632-83947654 CATTTTAAAAAAATGGGCAAAGG - Intergenic
1121037551 14:90718944-90718966 AATTCTCAAAAGAAGAGGGAAGG - Intronic
1121793037 14:96713125-96713147 CTTTTTAAAAAGAGGGGAAAGGG - Intergenic
1122423268 14:101590599-101590621 CCCTGTGAAAAGAAGGGGGAAGG - Intergenic
1123064112 14:105607443-105607465 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1123073423 14:105653086-105653108 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1123093348 14:105751853-105751875 AACTTTAAAAAGTTGGGGGATGG - Intergenic
1125130132 15:36274922-36274944 CAATTTAAAAAGAAGTGGTTTGG - Intergenic
1125141233 15:36410225-36410247 CATTTTTTAAAAAAGGGGCATGG - Intergenic
1126300177 15:47185499-47185521 CATTCTAAAAAAAGGAGGGAGGG - Intronic
1126354384 15:47779847-47779869 CTTTTTAAAAAGTAGGGGGAGGG - Intergenic
1126506325 15:49407526-49407548 AATTTTAAAAATAGGGGAGAGGG - Intronic
1126644743 15:50863874-50863896 ATTTTTTAAAGGAAGGGGGAGGG - Intergenic
1127354292 15:58183166-58183188 ATTTTTAAAAAGCAGGGGAATGG - Intronic
1127840633 15:62828348-62828370 CCTTTTCAAATGAAGGGGAAGGG + Intronic
1127870294 15:63067413-63067435 AATTTAAAAAAGAATGAGGAAGG - Intronic
1127895915 15:63298736-63298758 CATTTTAAAAATAAAGGAAATGG + Intronic
1128010837 15:64294608-64294630 CATTTTAAAAAGATAGGGAAGGG + Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1128438819 15:67683462-67683484 CATTTTAAAAGAAAGGGAGGCGG + Intronic
1128704538 15:69828978-69829000 CATTTTAAAACAAAGGGGGTAGG + Intergenic
1128845098 15:70886468-70886490 AATTTTAAAAAGCAGAGGAAGGG + Intronic
1129872096 15:78947104-78947126 CATTTTTAAAAAGAGAGGGAAGG - Intronic
1130174717 15:81556311-81556333 CATTTTCATAAGAAAGAGGAAGG + Intergenic
1130643482 15:85701943-85701965 TCTTATAAAAAGAAGGGGGTAGG + Intronic
1130949630 15:88575302-88575324 CATTTTACAAAAGAGGGGAAGGG - Intergenic
1131640863 15:94291752-94291774 CATTTTAAAAATAAGGTTTAAGG - Intronic
1131858590 15:96626821-96626843 CATTTAAAAATAAAGGGGGGTGG + Intergenic
1131903999 15:97121000-97121022 CATTTTAAAAATATGGGCAAAGG + Intergenic
1132169818 15:99638552-99638574 AATTTTAAAAAGCAGGAGAAAGG - Intronic
1132170921 15:99653689-99653711 CATTTTAAAAACAATATGGAAGG - Intronic
1133085945 16:3363626-3363648 CATTTTAAAAAGAATATGCATGG + Intergenic
1133820178 16:9229046-9229068 CATTTAAAATAGACTGGGGAGGG + Intergenic
1135083543 16:19456562-19456584 CATTTTAAAAATAATGTGAATGG + Intronic
1135934371 16:26767268-26767290 CATTTTAAAGTGGAGGAGGAAGG - Intergenic
1136382606 16:29902813-29902835 CTTTTAAAAAAGAAGGTGTAGGG - Intronic
1137451122 16:48575359-48575381 CTTTTAAGAAAAAAGGGGGAGGG + Intronic
1137479382 16:48838941-48838963 CATTTGAAAAATAAGGAGGTTGG + Intergenic
1137729615 16:50680123-50680145 CCATTTAAAGAGGAGGGGGAAGG + Intronic
1137911827 16:52385308-52385330 AATTTAAAGAATAAGGGGGAGGG + Intergenic
1138113385 16:54341862-54341884 CATTTGAAAAACAAAGGGCATGG - Intergenic
1139020305 16:62740578-62740600 AATGTTAAAAAAAAGGGGGAGGG + Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1139662341 16:68429711-68429733 CATTTTGAAAAGCACGGAGAAGG - Intronic
1140494327 16:75370403-75370425 TATTTTAAAAATAATGTGGAGGG + Intronic
1140593268 16:76378121-76378143 GATTCTAAAAAGAGGGAGGATGG + Intronic
1140684954 16:77424583-77424605 CTTTTTAAAAAGAAGAGCCAAGG - Intronic
1140722072 16:77780974-77780996 CATCTCAAAAAGAAGAGGGAGGG + Intergenic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141137078 16:81473461-81473483 TATTTTAAAAAGAAGAAGAAAGG - Intronic
1141311702 16:82919684-82919706 CATTTTAAAAGAAATGGAGAAGG + Intronic
1142245312 16:88967619-88967641 CTTTCTATAAAGAAGAGGGAAGG + Intronic
1142627703 17:1203180-1203202 CCTTTTAAAAGGAATGGGGCTGG - Intronic
1142872123 17:2827826-2827848 CCCTTGAAAAACAAGGGGGAGGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143432178 17:6895249-6895271 GATTTGAAAAAGGAGGGGGATGG + Intronic
1143692409 17:8580229-8580251 CTTTTCAAAAAGAAGGATGATGG - Intronic
1144092210 17:11868245-11868267 CAGTTTAAAAAGCAGGTGGTGGG - Intronic
1144197480 17:12908626-12908648 CATTTTAAAATGAGGTAGGATGG - Intronic
1144601252 17:16616640-16616662 AATTCTACAAAGAAGGGAGAGGG + Intergenic
1144622600 17:16827786-16827808 TATTTTAAAAAGAAGTGGGGAGG + Intergenic
1144991934 17:19238733-19238755 AATATTAAAAATAAAGGGGAAGG - Intronic
1146306567 17:31734224-31734246 CATTTTAAAAAGCACCTGGAGGG - Intergenic
1146989101 17:37251072-37251094 CATTTTAAAAGGAGGTGGGTGGG + Intronic
1147477697 17:40728703-40728725 AATTTTAAAAGGAAGGAGGCCGG - Intergenic
1147576936 17:41607712-41607734 TATTTAAAAAAGAAGTGGGCAGG + Intergenic
1147750465 17:42729116-42729138 CAATTTAAAAAAAAGAGGCAGGG + Intronic
1149171853 17:53821707-53821729 GATTTTGAAAAGAAGGTGGAAGG - Intergenic
1149652843 17:58287909-58287931 ATTTTTAAAAAGAATGAGGAAGG - Intergenic
1149802260 17:59580783-59580805 CTGTTTCAAAAGAAGGGGGCTGG + Intronic
1149824967 17:59819745-59819767 CATTTAAAAAATAAGGGGTTGGG - Intronic
1149844231 17:59994706-59994728 CTGTTTCAAAAGAAGGGGGCTGG - Intergenic
1150370786 17:64636140-64636162 CATTTCAAAAAAAAGGGCAAAGG - Intronic
1150769474 17:68029123-68029145 CATTTTAAAAAGAAAAAGAAAGG + Intergenic
1151009465 17:70476808-70476830 CTTTTTAATAAGAAGTGTGATGG - Intergenic
1151172248 17:72256746-72256768 TATTTTTAAAAGGATGGGGAGGG + Intergenic
1151316413 17:73325252-73325274 CAATTTTAAAAGTCGGGGGAGGG + Intergenic
1151704914 17:75762313-75762335 CCTCTTAAAAAAAAGGGGGTGGG + Intronic
1151709429 17:75793765-75793787 ACTTTTAATAAGGAGGGGGAAGG + Intronic
1151983593 17:77528434-77528456 GAAATTAAAAAGCAGGGGGAGGG - Intergenic
1152511838 17:80795256-80795278 CATTTTAATAATAAGAGTGAAGG - Intronic
1152593247 17:81223718-81223740 CTTTTTAAAAAGCGGGGGCAGGG - Intergenic
1153356859 18:4146534-4146556 CATTATAAAAAGAAGGGTTTAGG - Intronic
1153870077 18:9310198-9310220 CATTTTAAAAAGTAAAAGGATGG + Intergenic
1154066252 18:11110112-11110134 AATTTTAAAAAGAAAAGGAAAGG - Intronic
1155049931 18:22138087-22138109 CAAATTAAAAAAAAGGGGGGGGG - Intergenic
1155993460 18:32304903-32304925 TATTTTTAAAAGGAGGGGTATGG + Intronic
1156017983 18:32567804-32567826 CTGTTTAAAAAAAAGGGGGGGGG - Intergenic
1156403466 18:36761076-36761098 TATTTCTAAAAGCAGGGGGAAGG - Intronic
1156541384 18:37914863-37914885 TATTTGGAAAAGAAGGAGGAGGG - Intergenic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1157208823 18:45723496-45723518 AAATTTAAAAAGAAGGGGGAAGG + Intergenic
1158287825 18:55904344-55904366 CATTTGTAAAAGAATGGGGCCGG + Intergenic
1158574128 18:58621968-58621990 CATTTTAAACAGCAGGGGAGAGG - Intronic
1158632340 18:59126481-59126503 CAAATTAATAAGAAGGGAGAGGG + Intergenic
1158926867 18:62274290-62274312 TAATTTAAAAAGTAGGGGAAAGG + Intronic
1159401423 18:67940821-67940843 CATTTAGAAAAGAAGATGGATGG + Intergenic
1159459177 18:68701124-68701146 CATTTTTAAAAAGTGGGGGAAGG + Intronic
1159532624 18:69673983-69674005 CATTTTAAAATGCAGTGGGTGGG + Intronic
1161147284 19:2686456-2686478 ATTTTTAAAAAGGAGGGGGGAGG - Intronic
1161404944 19:4086276-4086298 CATTTTAAATAGAAAGGGCTGGG - Intergenic
1161715100 19:5871624-5871646 CAATTTAAAAATAAGGTGGCTGG + Intronic
1163252242 19:16132861-16132883 CAGTTAAAAAAGAAGAGTGAGGG - Exonic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164663282 19:29998945-29998967 TATTTTAAAAAGAAGTGAAAAGG - Intronic
1164747916 19:30629554-30629576 CTTTTGTAAAAGAAGGGGCAAGG + Intronic
1165702278 19:37947785-37947807 CATATTACAAATAAGGGGGCTGG - Intronic
1166287839 19:41843312-41843334 CATTTTATAAAGAAGGTAGTAGG - Intronic
1166453904 19:42924093-42924115 CAATTTTAAAAGAATGGGGTGGG - Intronic
1166765063 19:45247909-45247931 ATTTTTAAAAAGGAGGGGGACGG - Intronic
1167261414 19:48461018-48461040 AATTTAAAAAAGAAGGTGGCTGG + Intronic
1167890563 19:52536319-52536341 GACTTTAAAAAGAACGGGGTGGG - Intronic
1168092116 19:54092893-54092915 CATTTTAAAAAAAAGAGGGCCGG + Intergenic
925806545 2:7656009-7656031 TATTTTATAAAGAAGGGTGAAGG - Intergenic
926428410 2:12761214-12761236 CATTTTTAAAAGATGATGGATGG - Intergenic
926652257 2:15359142-15359164 CAACTTAACAAAAAGGGGGATGG - Intronic
927330298 2:21854831-21854853 CCTTTTACACAAAAGGGGGAAGG + Intergenic
927334858 2:21909989-21910011 AATTTGAAAAAGAAGAGAGACGG + Intergenic
927410815 2:22824230-22824252 CAATTTGAGAAGAAGGGGGAAGG + Intergenic
927545059 2:23945073-23945095 CTTATTAAAAAAAAGGGGGGAGG + Intronic
927854716 2:26520728-26520750 CTTTATAAAATGAAGAGGGAAGG + Intronic
928469511 2:31560059-31560081 CTTTTTAAAAAAAGGGGGGGGGG - Intronic
928526302 2:32144879-32144901 CATCTCAAAAAAAAGCGGGAGGG + Intronic
928704126 2:33929420-33929442 AAGTTTTAAAAGAAGGTGGAAGG - Intergenic
929087539 2:38183274-38183296 CATTTTAAAAAGAATTGGCAAGG - Intergenic
929359155 2:41063257-41063279 CATTTTAAAGAGAAGTGAAAAGG + Intergenic
929433407 2:41907746-41907768 CATAGTAAAAACAAAGGGGAGGG + Intergenic
930159759 2:48143016-48143038 AATTTTGAAAAGAAGGGAGAAGG - Intergenic
930900709 2:56504644-56504666 CATTTTAAAAATTATGGGGTAGG + Intergenic
930926794 2:56827996-56828018 CATTTTATAAAGAAATGGCATGG + Intergenic
931087212 2:58845984-58846006 TATTTTTAAAAGAAGGGAAAGGG - Intergenic
931271855 2:60710570-60710592 CATTTTAAAAAAAAAGGGATGGG + Intergenic
931933207 2:67164919-67164941 CATTTGTAAAAGAAGTGGGCTGG - Intergenic
932021289 2:68089874-68089896 TTTCTTAAAAAGAAGAGGGAGGG - Intronic
932289797 2:70567177-70567199 CAAGATAAAAAGAAGTGGGAAGG - Intergenic
932943264 2:76194941-76194963 CATTTGAAAAAGCAGGGTGCAGG - Intergenic
933951063 2:87330276-87330298 CATGTTATAAAGAATGGGGCAGG - Intergenic
934144470 2:89078071-89078093 CATGTTTAAAATAAGGAGGATGG - Intergenic
934224782 2:90122478-90122500 CATGTTTAAAATAAGGAGGATGG + Intergenic
934482768 2:94667732-94667754 GATTTTAAAAAGCAGGGGAGGGG - Intergenic
935113054 2:100109347-100109369 CATTTTAAAAAGAAAAAGGCAGG + Intronic
935180698 2:100688737-100688759 AATTTTAAAAATAAGTTGGAGGG - Intergenic
935225937 2:101053238-101053260 CATTTCAAAAAGAAGGAAGGTGG + Intronic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
935875575 2:107503295-107503317 CATTTCAAAAAGAAGACTGATGG - Intergenic
935975245 2:108571959-108571981 TATTTTAAAAAGGATGGGTAAGG + Intronic
935977800 2:108596393-108596415 CATTTTAAAAATAAGAGGTGAGG + Intronic
936036859 2:109120207-109120229 CATTTGTAAGAGGAGGGGGAGGG + Intergenic
936122579 2:109759766-109759788 CATTTTAAAAAGAAAAAGGCAGG - Intergenic
936135415 2:109888925-109888947 CATTTTAAAAATAAGAGGTGAGG + Intergenic
936209282 2:110482560-110482582 CATTTTAAAAATAAGAGGTGAGG - Intergenic
936222114 2:110611706-110611728 CATTTTAAAAAGAAAAAGGCAGG + Intergenic
936244947 2:110818617-110818639 AATTTTAAAAAGACGGGGGATGG + Intronic
936328712 2:111528302-111528324 CATGTTATAAAGAATGGGGCAGG + Intergenic
937424271 2:121785141-121785163 TATTTTAAAAAGTATGGGGCCGG - Intergenic
937661192 2:124431405-124431427 CATTATAAAATGAAGAGGAATGG + Intronic
939816454 2:146902867-146902889 TTTTTTAAAAAAAAGGGAGATGG - Intergenic
940133347 2:150408821-150408843 AATTTTAGAAAGAAGGGGAGTGG - Intergenic
940535232 2:154932661-154932683 TTTTTTAACAAGAAGGGGTATGG + Intergenic
941102093 2:161308005-161308027 TTTTTTTAAAAGAGGGGGGATGG - Intergenic
941173735 2:162171418-162171440 CATTTGAAAAACAAAGGGGTTGG + Intronic
941268124 2:163389759-163389781 CATTTCAAAAAGAAAGGTCACGG + Intergenic
941389864 2:164898145-164898167 CATATTAAATAAAAGGGGGATGG + Intronic
942074310 2:172342563-172342585 TCTTATAAAAAGGAGGGGGAGGG - Intergenic
942163657 2:173219190-173219212 CATTTTAAAAAGGAAGTGGCTGG + Intronic
942427527 2:175875891-175875913 TATTTTAAAAAGATGGGGTAGGG - Intergenic
942944569 2:181658220-181658242 CATATTGAAAAGAAGGAGTAGGG + Intronic
943175271 2:184465133-184465155 ATTTTTGAAAAGAAGGTGGAAGG + Intergenic
943314706 2:186372600-186372622 TATTTTAAAAAAAAGAGTGAGGG + Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943591665 2:189805226-189805248 CACATAATAAAGAAGGGGGAGGG + Intronic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
945121428 2:206461509-206461531 AATTTTAAAAATAAGGAGGTTGG + Intronic
945842363 2:214903296-214903318 CATTTTTAAGAGGAGGTGGAGGG + Intergenic
946634449 2:221708786-221708808 GATTTTAAAAAGAAAAGGGAGGG - Intergenic
947250264 2:228095038-228095060 CAATTTAAGATGAAGGGTGAGGG + Intronic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
948156323 2:235785902-235785924 CCTTTTAAAAAAAACGTGGATGG + Intronic
948172538 2:235916618-235916640 CATTTTAAAAACAAGGAAGCTGG - Intronic
1169829016 20:9802401-9802423 CATTTTATAAATATGGGAGAAGG + Intronic
1169896948 20:10514216-10514238 CATTTTAAAAAGTTGGGGCCAGG - Intronic
1169996096 20:11558324-11558346 CATTTTAAAAAGCGGAGTGACGG - Intergenic
1170466444 20:16626692-16626714 CATCTCAAAAAAAGGGGGGAGGG - Intergenic
1170498833 20:16953830-16953852 GATTTTATAAAGCAGGGGGCAGG - Intergenic
1170733821 20:18996375-18996397 AATTTGGAAGAGAAGGGGGAGGG + Intergenic
1170970440 20:21111092-21111114 AATTTTAAATAGAAGGTAGAGGG - Intergenic
1172290224 20:33770683-33770705 CAATTAAAAAAGAATGGGCAGGG + Intronic
1172363958 20:34334722-34334744 CATTTTAAAAAATTGGGGCAAGG - Intergenic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1173171757 20:40731519-40731541 TATAATAAAAAAAAGGGGGAGGG - Intergenic
1173331550 20:42079921-42079943 TATGTCAAAAAGAAGGGGGCGGG - Exonic
1173336691 20:42117808-42117830 CATCTTAAAAAGAAAGGAAAAGG - Intronic
1173488789 20:43461246-43461268 AATTCTACAAAGAAGGGAGAGGG - Exonic
1173683901 20:44909711-44909733 CATTTTACAGAGAAGGGAAACGG + Intergenic
1174236046 20:49092839-49092861 GATTTTTTAAAAAAGGGGGAAGG - Intronic
1174462602 20:50693410-50693432 TTTTTTAAAAAGAAGGAAGATGG - Intergenic
1174708750 20:52683773-52683795 CATTTTAAAAACATAGAGGAGGG + Intergenic
1174786722 20:53439751-53439773 CAGTTTGAAAACAAGGGGGGTGG - Intronic
1175362223 20:58421670-58421692 TATTTTAAAGAGAGGAGGGAGGG + Intronic
1175640576 20:60626484-60626506 CATTTTCAAAAAGAGGGGAAGGG + Intergenic
1176164676 20:63666537-63666559 TGTTTCAAAAAAAAGGGGGAGGG - Intronic
1177582589 21:23045842-23045864 CATTTAAAATCGAATGGGGATGG - Intergenic
1178027249 21:28482431-28482453 CATTCTAAAAAGAAAGGAAATGG + Intergenic
1178220556 21:30653125-30653147 CATTGGAGAAAGAAGGGAGAAGG + Intergenic
1179589100 21:42393820-42393842 TATTTACAAAAGAAGGGGGTGGG + Intronic
1179589455 21:42396861-42396883 CATTATAAAAACAAGTGTGATGG + Intergenic
1179616383 21:42586206-42586228 CATTTTAAATGGGAGGGGAAGGG - Intergenic
1182264754 22:29105552-29105574 AATTTTAAGAAGAAAGGGGCAGG + Intronic
1182342425 22:29634386-29634408 CATTTTAAAAACAAAGTAGAAGG + Intronic
1182384508 22:29925491-29925513 CATTTTAAAAAGAAGGAACCAGG + Intronic
1182592459 22:31392298-31392320 CCTTTTAAAAAGAAGAGACAGGG - Intergenic
1182652934 22:31866682-31866704 CATTTTAAAAAGTAAGGAAAGGG - Intronic
1182720300 22:32392916-32392938 TATTTTAAAAAGCAGGTGGTGGG - Intronic
1184868400 22:47217359-47217381 CATTTGGAAAAGAAGGGAAATGG - Intergenic
1184919523 22:47595913-47595935 TATTTTAAAAATAAGAGGGGAGG + Intergenic
1185354141 22:50356262-50356284 TGTGTTAAAAAGAAGAGGGAAGG - Intronic
949116050 3:324888-324910 AATTTTAAAAAGTAGGGAGTGGG - Intronic
949199949 3:1364576-1364598 CATTTTTAGAAGCAAGGGGATGG - Intronic
950373939 3:12555006-12555028 AATTTTAAAAATAAGTGGCATGG + Intronic
950895037 3:16440848-16440870 CATTTGATAAAGTTGGGGGATGG + Intronic
952029876 3:29128884-29128906 ATTTTTAAAAAGAAGGGGCTTGG + Intergenic
952089730 3:29870176-29870198 CGTTCTAAAAAGGAGGTGGAGGG + Intronic
952248093 3:31619554-31619576 TATTTAAATAAGAAGGGGTAGGG + Intronic
952385076 3:32834835-32834857 CATCTCAAAAAAAAAGGGGATGG + Intronic
952591043 3:34954043-34954065 CATTTGATAAAGATGGGGTAAGG + Intergenic
953691112 3:45120454-45120476 CATTGTAAAATGAAGGGGTGGGG + Intronic
954295440 3:49672148-49672170 CATTTTAAACAGAAGCCAGAAGG + Intergenic
954908040 3:54079542-54079564 CATTTGAATAAGAATGGGGGAGG + Intergenic
954957078 3:54530688-54530710 CATTTATAAAATGAGGGGGATGG - Intronic
955129617 3:56152404-56152426 CAATTTAAAATGAAGGGGGGGGG + Intronic
955197085 3:56814657-56814679 CATTTAAAAAAAAAGGGAGAAGG - Intronic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
956187675 3:66578049-66578071 CATTTTATGAAGAAGGGAGGAGG - Intergenic
956403334 3:68903054-68903076 AATGTTAACAAGAAGAGGGAGGG - Intronic
956684326 3:71810270-71810292 TATTTTAAAAAGAAGAGAAAAGG + Intergenic
956873208 3:73438509-73438531 CATGTCAAAAAGAAGTGAGATGG + Intronic
957435376 3:80168529-80168551 CATTTTACTAGGAAGGGGGTTGG - Intergenic
957457394 3:80469686-80469708 TATTTTAAAAAGAAGGGAAAAGG - Intergenic
957805746 3:85146899-85146921 CATTTGAAAAGGAAGGGATAGGG + Intronic
958704476 3:97637112-97637134 TATTTTAAAATCAAGGTGGAGGG + Intronic
958895553 3:99825376-99825398 GAATTTAAAAAGCAAGGGGAAGG + Intronic
959658470 3:108838216-108838238 CATTGTACAAAGGAGTGGGAAGG - Intronic
959716170 3:109435119-109435141 CATTTTAAAAGTAAGGAGAATGG + Intergenic
960389191 3:117056036-117056058 CATTGTAAACAGAAAGGAGATGG - Intronic
960822846 3:121752822-121752844 TATTTTCACAAGAAGAGGGAAGG + Intergenic
961005293 3:123401398-123401420 CATTTTTTAAAGTAGAGGGATGG - Intronic
961244930 3:125442742-125442764 CATCATAAAAAGAGGTGGGAGGG + Intergenic
961339021 3:126205002-126205024 CATTTTAAACAGAGTGGTGAGGG + Intergenic
961340683 3:126215390-126215412 CATTTTGAGAAGAAAGGTGAAGG - Intergenic
961754040 3:129116566-129116588 CACTTCAAAAAGAGGGGGCAGGG - Intronic
962247884 3:133812683-133812705 AATGTTTAAAAGATGGGGGAGGG - Intronic
963453279 3:145512393-145512415 CATTTAAAATATAAGTGGGAAGG - Intergenic
963589490 3:147239292-147239314 GATTTTAAAAAGAAGGAAGAAGG + Intergenic
963708827 3:148722535-148722557 CATTCTAAGAAGAGGCGGGAGGG + Intronic
963730873 3:148970813-148970835 CAGTTAAAAAATAAGGGGGAGGG - Intergenic
963870066 3:150407301-150407323 CAGTTAAAAAAAAATGGGGATGG - Intergenic
963930996 3:151004250-151004272 CATTTTAAAAAGAAAGAATAAGG + Intergenic
964799062 3:160533320-160533342 TATTTTAAAAAATAGGGGGCTGG - Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965949359 3:174287016-174287038 TTTTTTAAAAAGAAGGGCAAAGG + Intergenic
966097569 3:176222633-176222655 GATTTTAAAAAGAGGGGAAAGGG + Intergenic
968026179 3:195443944-195443966 CATCTTAAAATGAAGGAGTATGG - Intergenic
968113425 3:196069101-196069123 CATTTTTAAAAAAAGTGGCAGGG - Intronic
968854613 4:3110294-3110316 CATATTACAAAGAAGTTGGAAGG - Intronic
969104444 4:4794628-4794650 CATTTTCAGAAGAAGCAGGATGG - Intergenic
969429194 4:7144254-7144276 CATTTTAATAAAAATGGTGATGG + Intergenic
969712809 4:8853848-8853870 CATCTCAAAAAAAAGGGGGGCGG + Intronic
969862697 4:10050268-10050290 CATTTTAGAAAGAAGGCACAAGG - Intronic
970220953 4:13810358-13810380 CATTCTAAAAAGAAATGGCAGGG + Intergenic
970456568 4:16228357-16228379 CCTTTTAAATAGAAGAGAGAGGG + Intergenic
971770404 4:30888172-30888194 CATTTTAAAAAGAAATGGGCCGG - Intronic
971772550 4:30915821-30915843 CAATTTGAAAAAAAGGGTGAGGG - Intronic
972626249 4:40802174-40802196 CATTTTAAACCAAAGGGGAACGG - Intronic
972822032 4:42713030-42713052 GACTTTCAAAAGAAGGGGAAAGG + Intergenic
972899324 4:43663301-43663323 CAATTTAAACAGAAGCGGGAAGG - Intergenic
972921725 4:43950817-43950839 CATTTTGAAAACAAGAGGAAAGG - Intergenic
973269878 4:48251735-48251757 TATTATAAAAAGAAGAGGGGTGG + Intronic
973742245 4:53929365-53929387 CATTTTAGAAAGAAGAAAGAAGG - Intronic
974132944 4:57778593-57778615 AATTTTCAAAAGAAGAGGAAAGG - Intergenic
974761281 4:66277266-66277288 CATTTTAAAAAGAAGATGCATGG + Intergenic
975940898 4:79644370-79644392 TAGGTTAAAAAAAAGGGGGAAGG - Intergenic
976788100 4:88845486-88845508 CATTTTGGACAGAAGGGCGAGGG + Intronic
976831281 4:89317630-89317652 TGTTTTAAAGAGAAGAGGGATGG + Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977182154 4:93889358-93889380 CATTTCATTAAAAAGGGGGATGG + Intergenic
977594959 4:98868369-98868391 CAAATTAAAAAGAAGCTGGAGGG - Intergenic
977628246 4:99212634-99212656 CATTTTAAAAGGCTGGGGGTGGG - Intronic
978396862 4:108290022-108290044 TATTTTAAAAAGATAAGGGAGGG - Intergenic
978643751 4:110903521-110903543 CTTTTTACAAATGAGGGGGAGGG + Intergenic
979268023 4:118725960-118725982 CATTTCTAAAGGGAGGGGGATGG + Intronic
979602425 4:122601047-122601069 CATTTTACAAAGAGTGGGAAGGG + Intergenic
979999246 4:127469446-127469468 CTTGGTAAAAAGAAGAGGGAGGG - Intergenic
980071163 4:128243958-128243980 CATTTTTAAAAGGTTGGGGAAGG - Intergenic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980319162 4:131245625-131245647 TATTTTAAAAAGCATGTGGAAGG - Intergenic
980622635 4:135329046-135329068 CATTTTACATAGAAGGGTTATGG - Intergenic
980640325 4:135569164-135569186 CATTTTAAAAGGAAAAGAGAGGG - Intergenic
980947873 4:139340790-139340812 AAGCTTAAAAAGAAGGGGAAGGG - Intronic
980949232 4:139355991-139356013 AATTTTAAAAAGGAGGGAGTGGG - Intronic
981120685 4:141047773-141047795 AATTTTAAAAGAAAGAGGGATGG - Intronic
981499864 4:145438619-145438641 GATTTTTAAACGCAGGGGGAAGG + Intergenic
981793869 4:148572497-148572519 AATTTTAAAAAGAAAGAGCAAGG + Intergenic
981908644 4:149953042-149953064 CATTTTTAAAAGAAGGAGAGAGG + Intergenic
981958587 4:150508227-150508249 AATTTAAAAAAAAAGGGGGGGGG + Intronic
982213818 4:153063203-153063225 AATTTTAAAAAAAAGGTGGAGGG + Intergenic
983650054 4:170028118-170028140 AATTTAAAAGAGATGGGGGAGGG - Intronic
983782098 4:171681997-171682019 CATTTTAAAGAAAAAGGGCAGGG - Intergenic
983939051 4:173522827-173522849 ATGTTTAGAAAGAAGGGGGAGGG - Intergenic
984181838 4:176493030-176493052 CATCTAAAAAAAAAGGGGGGGGG - Intergenic
984203460 4:176756571-176756593 CCTTTTGAAAAGAACGGGCATGG + Intronic
984239798 4:177204497-177204519 GAATTTAAAAAGAACAGGGAGGG + Intergenic
984802833 4:183730455-183730477 CATTTTCAAAAGAATGGTGCTGG - Intergenic
985018043 4:185657799-185657821 CATTTTATGAAGAAGGCTGAGGG + Intronic
985350384 4:189055189-189055211 CATTTTAAAAAGAAAGGCTGTGG - Intergenic
985500707 5:242845-242867 CATGCTAATAATAAGGGGGAAGG + Intronic
986004775 5:3658451-3658473 CATTTTAAAAACAAAGAGAAGGG - Intergenic
986726360 5:10601114-10601136 CAGTTTAAAAAGAATAGGGTTGG + Intronic
987085025 5:14460215-14460237 CATTTTAAAAAGAAATGTGAGGG - Intronic
987361013 5:17106484-17106506 CCAATTAAAAAAAAGGGGGAGGG - Intronic
987797705 5:22651340-22651362 CAATTTAAAAAGGAAGGGGGAGG + Intronic
988085052 5:26464461-26464483 CATTTGAAAAACATGGGGGTTGG - Intergenic
988838192 5:35054855-35054877 CATTTTAAAAATAGCTGGGAAGG + Intronic
988884650 5:35542958-35542980 CATTTTAAGAGGAAGGCAGAGGG + Intergenic
988943308 5:36168120-36168142 CATTTTAAAATGAATGAAGATGG + Intronic
989620978 5:43384170-43384192 CATTATAAAAATAAGAGAGATGG + Intronic
989796833 5:45484535-45484557 CATTTTAAAAGGAAGAGAGGGGG - Intronic
990778819 5:59334879-59334901 CATTTCAAGAAGAAATGGGAAGG - Intronic
991620205 5:68537149-68537171 TATTTTTAAATAAAGGGGGAAGG + Intergenic
991916929 5:71614783-71614805 CATTTTTAAAAGATGGGGTCTGG - Intronic
992002705 5:72451294-72451316 CATCTTAAAAAGCGGGTGGATGG - Intronic
992129466 5:73676605-73676627 CATTTTCTCAAGGAGGGGGAAGG + Intronic
992727109 5:79618528-79618550 CTATTTAAAAAGAAAGGGGCCGG - Intronic
992769264 5:80032111-80032133 TATTTTAATAAGAAGTGGCATGG + Intronic
992899934 5:81284456-81284478 TATTTTAATAGGAAAGGGGAGGG + Intergenic
993396232 5:87392671-87392693 GATTTTAAATAAAAGGGAGAAGG - Intronic
993825501 5:92680742-92680764 CATTTTAAAATGAATGGCCATGG + Intergenic
993964359 5:94343221-94343243 CATATTCAAAAAAAGGTGGAAGG - Intronic
994520231 5:100824649-100824671 CATCTGAAAAAAAAGGTGGAGGG + Intronic
994689409 5:102998745-102998767 CATTAAAAAAAGAGGGGGAAAGG + Intronic
994714440 5:103304912-103304934 TATTATCAAAAGAAGGGGAATGG + Intergenic
995090352 5:108168283-108168305 AATTTAAAAAAGAGAGGGGAAGG + Intronic
995120264 5:108529011-108529033 CAAGATAAAAAGAAGGGGAAAGG + Intergenic
995510871 5:112908027-112908049 GATTAAAAAAAGAAGGGGGCGGG + Intronic
995948210 5:117676729-117676751 CAACTTAAAAAGAAGGGCAATGG - Intergenic
996370271 5:122745927-122745949 GATTTTACAAAGATGGAGGAAGG + Intergenic
997045556 5:130312649-130312671 CCTGTTAAAAAGAGGGAGGATGG - Intergenic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998100636 5:139430869-139430891 GATTTTAAAAAGAATGAGGTAGG - Intronic
998479296 5:142448539-142448561 TATATTAAAAAGTAGGGGGCTGG - Intergenic
999594299 5:153185079-153185101 CATTTTAAGAACATGTGGGATGG - Intergenic
1000368274 5:160510963-160510985 CGTTTTACAGAGAAGGGAGATGG + Intergenic
1000730209 5:164825783-164825805 CATTTTAAAAAGGAGTAAGAGGG + Intergenic
1000902184 5:166924561-166924583 TATTTTAAAAACAAGGGTTAGGG + Intergenic
1000937697 5:167322595-167322617 GATTTAAAAAAAAAGGGGGAGGG - Intronic
1001255385 5:170179176-170179198 CATTTTAACAAGCAGAGGGCAGG + Intergenic
1001259132 5:170212072-170212094 CATTTTACAAAGAAGGGAACTGG + Intergenic
1001906205 5:175475766-175475788 GATTTTAAAAAGAAGGAAAAAGG + Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1003034440 6:2630956-2630978 CACTTCAAAAAGAAGGGGGTAGG + Intronic
1003328424 6:5110019-5110041 CACTTTAAAAAGAAGGGGGCAGG - Intronic
1003453131 6:6255837-6255859 GATTTTAAAAAGAAGATTGAGGG + Intronic
1003608727 6:7589598-7589620 TAATTTAAAAAGGAGGGTGAAGG + Intergenic
1003691905 6:8363235-8363257 CATTTTAGAGGGAAGGGGAAAGG - Intergenic
1004213886 6:13682884-13682906 CATTTTAAAAAGATGGGGTGTGG + Intronic
1004389563 6:15198666-15198688 TCTTTTAAAAAGGAGGGAGATGG + Intergenic
1004418799 6:15449238-15449260 TTTTTAAAAAATAAGGGGGAGGG - Intronic
1004441765 6:15661640-15661662 CATCTCAAAAAAAAGGGGGGTGG + Intronic
1004705407 6:18119877-18119899 CATTTTAAAAAGAAGTTCTATGG - Intergenic
1005425136 6:25694877-25694899 CATTTTATAAAAAAGGGCCATGG + Intronic
1005827701 6:29644875-29644897 CATTTTACAAAGAAGATTGAAGG + Intergenic
1005912599 6:30324546-30324568 CATTTTTAAATGACTGGGGAGGG + Intergenic
1006596563 6:35197128-35197150 CAAGTTAAAAAGATGGGGAAGGG - Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006874316 6:37282155-37282177 CATTTGAAAAAGAAAGAGAACGG - Intronic
1006882987 6:37355151-37355173 CATCTTGAAAAGACGAGGGAAGG + Intronic
1007038665 6:38701646-38701668 CATTGCAAAATTAAGGGGGAAGG - Intronic
1008052357 6:46913199-46913221 AGTTTTAAGAAGAAGGGGGCTGG + Intronic
1008616520 6:53231678-53231700 CCATTAAAAAAGAAGGTGGAAGG + Intergenic
1008825100 6:55684643-55684665 ATTTTTAAAAAGTAGGGGGGAGG + Intergenic
1009052521 6:58294009-58294031 AATTTTAAAAACAAAAGGGATGG + Intergenic
1009238586 6:61156606-61156628 AATTTTAAAAACAAAAGGGATGG - Intergenic
1010179657 6:73071052-73071074 CATCTAAAACAGGAGGGGGATGG + Intronic
1010319848 6:74493363-74493385 CATTTAAAAAAAAAGAGTGATGG - Intergenic
1010774212 6:79866640-79866662 CATTTTTAAAAGTATGGGTAAGG - Intergenic
1011605200 6:89096791-89096813 CATTTTAAAAACTAGGGGCTGGG - Exonic
1011721201 6:90158355-90158377 CATTTTGCAAGGAAGGGGAATGG - Intronic
1011998876 6:93628419-93628441 GATTTAAAAAAGGAGGGGGGAGG + Intergenic
1012340987 6:98122982-98123004 CATTTTGAAAAGAAAGAGGAAGG - Intergenic
1012582577 6:100886827-100886849 GATTTTTAAAAAAAAGGGGAGGG + Intergenic
1012946066 6:105466996-105467018 ACTTTTAAAAAGTTGGGGGAGGG + Intergenic
1013259945 6:108431887-108431909 AATTATAAAAAGAAAGGTGAGGG - Intronic
1014217172 6:118763625-118763647 GTTTTTAAAAAGAAAGGAGATGG + Intergenic
1014730023 6:125021883-125021905 CATCTCAAAAAAAGGGGGGAAGG - Intronic
1015498809 6:133908952-133908974 CATTTTTAAAAAAATGGGAAGGG + Intergenic
1015516672 6:134089196-134089218 CATTTTGATAAGAGGGGTGAGGG + Intergenic
1015856159 6:137626662-137626684 AATTTTAAAAAGCAGGGGAGCGG + Intergenic
1017052488 6:150406862-150406884 GTTTTTAAAAATCAGGGGGAGGG - Intergenic
1017060347 6:150478506-150478528 CATTTTAAAAACATGGTGGGAGG - Intergenic
1017195794 6:151698657-151698679 CAATTTAAAAAGAAAAGGCAAGG + Intronic
1017846763 6:158265275-158265297 TATTTTAAAAAGGAGGGGTGGGG - Intronic
1017924492 6:158899041-158899063 AAAGTTAAAAAGCAGGGGGATGG - Intronic
1018079576 6:160247348-160247370 GATTATAAAAAAATGGGGGATGG - Intronic
1018786357 6:167111076-167111098 CATTTGAAAAAGGAAGGAGAGGG + Intergenic
1019020951 6:168917176-168917198 GCTTTTAAAAAGGAGGGGAAGGG + Intergenic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1020208837 7:6142580-6142602 CTTTTAAAAAATAAGGGGCACGG + Intronic
1020954303 7:14720637-14720659 CATTTTAAAAAGAAAGGGGCCGG - Intronic
1021201671 7:17734691-17734713 CATTTCAAAACAAAGGGGAATGG + Intergenic
1021257175 7:18406687-18406709 TATTTTAGAAAAAAAGGGGAAGG - Intronic
1021507168 7:21398594-21398616 TATTTGAAAAATTAGGGGGATGG - Intergenic
1022239279 7:28493567-28493589 CATGTTAAAACAAAGGGGAAGGG + Intronic
1022397844 7:30006883-30006905 TATTTTAAAAATAAGGGGTTTGG - Intergenic
1022867796 7:34440683-34440705 CATTAAAAATAGAAGGGAGAGGG + Intergenic
1023081178 7:36527890-36527912 CATTTTCCAAAGCAGTGGGAGGG - Intronic
1023878063 7:44301479-44301501 CATTTTGAAAAGAAGAGGCCGGG + Intronic
1024372142 7:48597763-48597785 CATTTTTAAAAAATGGAGGATGG - Intronic
1025028781 7:55539027-55539049 CCTTTAAAAAAAAAGGGGGGGGG + Intronic
1025866108 7:65382717-65382739 CATTTTAAAAAGAGAAGGAAGGG - Intronic
1025888016 7:65617057-65617079 CATTTAAAAAAGAAGGGAGGGGG - Intergenic
1025988023 7:66473080-66473102 CCTTTTAAATAGAAGAGAGAGGG - Intergenic
1027283868 7:76628777-76628799 AATTTGAAAAAAAAGGGGGGGGG + Intergenic
1027837566 7:83264613-83264635 CAAATGAAAAAGAAGGGGAAGGG + Intergenic
1028528968 7:91817153-91817175 CATTTTATGAAGAATGGGTAGGG - Intronic
1028847644 7:95500174-95500196 CATTTTCATAAGAATGGAGAAGG + Intronic
1028892810 7:96007718-96007740 CATTTTTAAAAGAAGGCTAATGG + Intronic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1029846585 7:103418182-103418204 TAATTTAGAAAGAAGGAGGAGGG - Intronic
1030046319 7:105500169-105500191 CACTTTAAAAAGAAGCAAGAAGG - Intronic
1030128006 7:106172876-106172898 CATGTAAAAAAGAACTGGGAGGG - Intergenic
1030247122 7:107395227-107395249 CACATTAAAAAGACGGGGAAAGG + Intronic
1031031133 7:116736387-116736409 CACTTTAAAAACAATGGGGGAGG + Intronic
1031712384 7:125065244-125065266 CATTTTAGCAAGAAGCTGGATGG - Intergenic
1031854372 7:126904685-126904707 TATTTAAAAAAGAAGGGAGGTGG + Intronic
1032164721 7:129536609-129536631 CATTTTAGAAAACAGGGGTACGG + Intergenic
1032340599 7:131069116-131069138 CTTTTTAAAAATAATGGAGATGG - Intergenic
1032552574 7:132798630-132798652 CAGATTTAAAAGCAGGGGGAAGG + Intronic
1033166599 7:139043794-139043816 TATTTTAAAAATAAGGGGTTTGG + Exonic
1033187468 7:139241535-139241557 TCTTTTAAAAAGAAGGGTAAGGG + Intronic
1034035532 7:147816532-147816554 AATTTTAAAAATAATGGAGATGG + Intronic
1034595218 7:152183458-152183480 CAATTTAGAAAGAAGGGGCTGGG + Intronic
1036546912 8:9780193-9780215 CATGTTAAAAAGGCGGGGGTGGG - Exonic
1036569731 8:9969629-9969651 AATTTTAAAAAGGAGGAGGATGG - Intergenic
1037462925 8:19131375-19131397 CATTTTACAGAGGAGGGTGAGGG + Intergenic
1037839719 8:22235314-22235336 CATTTTAAAAAGGTGGAGGGTGG + Intergenic
1038082363 8:24153354-24153376 CATGTTTAAAAAGAGGGGGAAGG + Intergenic
1038125024 8:24664013-24664035 CATCATAAAAATAAGGTGGAAGG - Intergenic
1038326860 8:26578360-26578382 ATTTTTAAAAAGGAGGGGAAAGG + Intronic
1038749013 8:30279134-30279156 TATTTTAAAAATAAGGAGTAAGG - Intergenic
1039216864 8:35281599-35281621 CCTTTCAAAAAGAAGAGGGCTGG - Intronic
1039750691 8:40475583-40475605 AATTTTTAAAAGAAGGGTGGGGG + Intergenic
1040429489 8:47324975-47324997 CATCCTTATAAGAAGGGGGAGGG - Intronic
1041033696 8:53765101-53765123 CCTCTTAAAAAGGCGGGGGAAGG + Intronic
1041165918 8:55092143-55092165 TTTTTAAAAAAGAAGTGGGAAGG + Intergenic
1041958482 8:63583727-63583749 CCTTTTAAGAAGGAGGGGGGTGG + Intergenic
1042259886 8:66847619-66847641 CTTTTTAAAAAGAAGGGGAGGGG - Intronic
1042465963 8:69130526-69130548 CATTTGAAAAAAAAAGGGGAAGG - Intergenic
1042686339 8:71445200-71445222 AGTTTTAAAAAGAATGAGGATGG - Intronic
1042805709 8:72768847-72768869 AATTTTCAAAAGAATGAGGAGGG - Intronic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043292589 8:78621606-78621628 AATTTTTGAAAGAAGGCGGAGGG - Intergenic
1043450595 8:80362243-80362265 CATTCCAAAAGGAAGGGGAAAGG - Intergenic
1043496463 8:80806255-80806277 CATCTTTCAAATAAGGGGGATGG + Intronic
1044418135 8:91959729-91959751 CATTTTAACAAGAAGATGAATGG - Intronic
1044631560 8:94284646-94284668 CATTTTAAAACAATGGGAGAAGG + Intergenic
1044928656 8:97231184-97231206 CATTTTAAAAAGACAGTGGCTGG + Intergenic
1045233205 8:100325858-100325880 AATTTTAAAAAGAGGAGAGAAGG - Intronic
1045745315 8:105412210-105412232 CATTGAAAAATGAAGGGGAAGGG - Intronic
1045881461 8:107045760-107045782 AAATTTAAAAAAAATGGGGATGG + Intergenic
1045910804 8:107407465-107407487 TGTTTTCAAAAGAATGGGGATGG + Intronic
1046501043 8:115077475-115077497 CTTTTTAAAAAGAAGGTCAAAGG - Intergenic
1047023961 8:120807433-120807455 CATTTTAAGGAGTAGGGGCAGGG - Intronic
1047106676 8:121739021-121739043 CATTTTCAAAACAAAGGGGTAGG + Intergenic
1047421973 8:124714765-124714787 TATTTTAAAAAGAACTGGGCAGG - Intronic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1048408826 8:134150695-134150717 CAGGTTAACAGGAAGGGGGAAGG - Intergenic
1049208386 8:141374036-141374058 CATTTTAAAAATGGGTGGGAAGG + Intergenic
1049276455 8:141722489-141722511 CAGTTTAATAAGGAGAGGGATGG + Intergenic
1050042056 9:1506366-1506388 AATTTTTAAAAGGAGAGGGAGGG - Intergenic
1050069414 9:1794724-1794746 GATTATAAATAGAGGGGGGAGGG + Intergenic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1050163349 9:2740391-2740413 GATTGTGATAAGAAGGGGGAGGG + Intronic
1050575349 9:6989380-6989402 AATTTTTAAAGGCAGGGGGAAGG - Intronic
1050818962 9:9853849-9853871 CATTTTAAAAATAACTGGGCTGG - Intronic
1050997567 9:12239382-12239404 AATTTTAAAAAAAAAGGGCATGG + Intergenic
1051169847 9:14309925-14309947 CATTTTAAAAAGCATGGCAAGGG - Intronic
1051464225 9:17359021-17359043 TATTTCAAAAAGAGAGGGGAGGG - Intronic
1051932032 9:22397591-22397613 CATTTGAAGAACAAGGGCGAGGG - Intergenic
1051984881 9:23072251-23072273 CATTTTTAAAATAAGATGGAAGG + Intergenic
1053180963 9:35969885-35969907 CATTAAAAAAAAAAGGGGGGGGG - Intergenic
1055176455 9:73323811-73323833 CTTGTTAAAAAGAAAGGGAAAGG + Intergenic
1055979209 9:81985312-81985334 CATATTAAAGAGAAGAGGAAGGG + Intergenic
1056957585 9:91094966-91094988 AAATTTAAAAAGTGGGGGGATGG + Intergenic
1057486294 9:95487116-95487138 TATTTTATAAACAAGGGGGCAGG + Intronic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1058062873 9:100516663-100516685 CTTTTTAAACAGAAGAGGAAGGG + Exonic
1058154556 9:101500663-101500685 CCTTTTGAAAAGAAGGTAGATGG + Intronic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1058636198 9:107040949-107040971 TTTTTTAAAAAGAAAGGGGATGG - Intergenic
1059029797 9:110679432-110679454 AATGTTAAAAATAAAGGGGAGGG - Intronic
1059045151 9:110858793-110858815 CATTCCAGAAAGAAGGGGAAGGG + Intergenic
1059330371 9:113531545-113531567 CAGTTTCAAAACAAGGGGAAGGG + Intronic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059633785 9:116153697-116153719 CATTTTGAGAAGAAGGAGGGAGG + Intergenic
1060256800 9:122038237-122038259 CATTTTAAAAAATAAGTGGAAGG + Intronic
1060556535 9:124510824-124510846 CATTTTATAGAGAAGAGAGAAGG - Intergenic
1060905522 9:127301369-127301391 CATGTGAAAAAGATGGGGGGTGG - Intronic
1061290083 9:129645794-129645816 CCATTTAGAAAGGAGGGGGAAGG - Intergenic
1186070493 X:5814438-5814460 CATTTTAAAAAGAATTGGCCAGG + Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1186445239 X:9621469-9621491 CCTTTTTAAAATAAGGGAGATGG + Intronic
1186523643 X:10228239-10228261 CATTTGAAAACTAAGGGGAATGG - Intronic
1186697401 X:12051696-12051718 CATTTATAAAAGGAGGGGGTGGG - Intergenic
1186759219 X:12705875-12705897 CATTTTTGAAAGAAGTAGGATGG + Intronic
1187607118 X:20897286-20897308 CATGTTTAAAAAAAGGGGTAAGG + Intergenic
1188004935 X:25010746-25010768 ATTTTTAAAAAGAAGGCAGAAGG - Intronic
1188046107 X:25427745-25427767 AATGTTAAAAAGCAAGGGGATGG - Intergenic
1188128764 X:26404008-26404030 CATATTAAAAAGAAAGAAGATGG + Intergenic
1188131571 X:26440488-26440510 GTTTTTAAAAAGTAGGGGCAGGG - Intergenic
1188474115 X:30571622-30571644 CATCTCAAAAAAAAGGGGGGGGG + Intronic
1188632040 X:32375878-32375900 CCCTTTAAAAAGGAAGGGGAAGG - Intronic
1188903510 X:35763153-35763175 CATTTTAAAATAAAGGGTGGTGG - Intergenic
1189204312 X:39224787-39224809 AATTTTAAAAAGAAAAAGGAGGG + Intergenic
1189406596 X:40730831-40730853 AAGTTTAAAAAAAAGGGGGCGGG + Intronic
1189462693 X:41254897-41254919 CTTTTTAAAAAAAGGGGGCAGGG - Intergenic
1189756245 X:44274608-44274630 ACTTTTAAAAAGTAGGGGGAGGG + Intronic
1189922266 X:45914073-45914095 AATTCTACAAAGAAGGGAGAGGG - Intergenic
1190239642 X:48647489-48647511 CATTTTAAAAAGAAGAGCACAGG - Intergenic
1190329357 X:49226241-49226263 TTTCTGAAAAAGAAGGGGGATGG + Exonic
1191010805 X:55756215-55756237 GTTTTGAAAAAGAAGGAGGAAGG + Intronic
1193378345 X:80788265-80788287 CAATTTAAAAAGATGGGGGCAGG + Intronic
1193593108 X:83414099-83414121 CAGTTAAAAAAAAAGGGGGGGGG + Intergenic
1194931857 X:99898363-99898385 CATTTAAAAAACAAGATGGATGG - Intergenic
1195431087 X:104790390-104790412 CTCTTTAAAAAGGAGGGTGAGGG - Intronic
1196391802 X:115214850-115214872 CTTATTTAAAAGAAGAGGGAGGG + Intronic
1196566203 X:117207684-117207706 AATTTTAAAAAGTAGTGGAAAGG - Intergenic
1196718200 X:118829396-118829418 GAGTTTAAAAAAAAAGGGGAGGG - Intergenic
1196763490 X:119222143-119222165 CATCTCAAAAAAAAGGGGGGGGG - Intergenic
1196803545 X:119564490-119564512 CATCTGAAAAAAAAGGGGGGGGG + Intronic
1197116956 X:122844784-122844806 CACTTTATAAAACAGGGGGATGG - Intergenic
1198123386 X:133617917-133617939 CATTTTAAAAACTAGGGGCTGGG - Intronic
1199111560 X:143941433-143941455 TATTTAAAAAAAAAGGGGGGGGG + Intergenic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1200279587 X:154765222-154765244 CATTTAAAGAGAAAGGGGGATGG - Intronic
1200757522 Y:7003797-7003819 CTTTTTTAAAATAAGGGAGATGG + Intronic
1201265876 Y:12206042-12206064 CATTTTAACAGAAAGGGGGAGGG + Intergenic