ID: 1087143632

View in Genome Browser
Species Human (GRCh38)
Location 11:94790643-94790665
Sequence ACTTCAGGGTGGAATTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087143632_1087143640 17 Left 1087143632 11:94790643-94790665 CCACAAAAATTCCACCCTGAAGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1087143640 11:94790683-94790705 TGTGTAAGGGAGTGGCATGCCGG 0: 1
1: 0
2: 1
3: 11
4: 167
1087143632_1087143637 4 Left 1087143632 11:94790643-94790665 CCACAAAAATTCCACCCTGAAGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1087143637 11:94790670-94790692 GTCCAAATCATTATGTGTAAGGG 0: 1
1: 0
2: 0
3: 10
4: 156
1087143632_1087143636 3 Left 1087143632 11:94790643-94790665 CCACAAAAATTCCACCCTGAAGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1087143636 11:94790669-94790691 AGTCCAAATCATTATGTGTAAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1087143632_1087143639 9 Left 1087143632 11:94790643-94790665 CCACAAAAATTCCACCCTGAAGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1087143639 11:94790675-94790697 AATCATTATGTGTAAGGGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 179
1087143632_1087143641 23 Left 1087143632 11:94790643-94790665 CCACAAAAATTCCACCCTGAAGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1087143641 11:94790689-94790711 AGGGAGTGGCATGCCGGCAGTGG 0: 1
1: 0
2: 11
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087143632 Original CRISPR ACTTCAGGGTGGAATTTTTG TGG (reversed) Intronic
903527984 1:24007436-24007458 ATTTAAGGATGTAATTTTTGGGG + Intergenic
904395468 1:30218340-30218362 ACTGCAGTGTGGAATATGTGTGG - Intergenic
908675343 1:66597205-66597227 ACTTCAGGGTGGAGGTTGGGAGG - Intronic
910376570 1:86578450-86578472 ACTTGAGGGTGGAGTTTGGGAGG - Intronic
911013327 1:93304987-93305009 ACGTCAGGGTGAAATAATTGTGG - Intergenic
911184967 1:94894108-94894130 ATTTCAAGGTGGATTTTTTTTGG - Intronic
911349912 1:96740520-96740542 ACTTCAGCATGTGATTTTTGGGG + Intronic
911480582 1:98435005-98435027 ACTTCAGGGTTGAAGTTTATTGG - Intergenic
913112527 1:115669340-115669362 GCTTCAGGGTCAAAGTTTTGGGG + Intronic
915430909 1:155866029-155866051 ACTTGAGGGTCCAATTTTTGTGG + Intronic
915581810 1:156817261-156817283 ACTTCTGGAAGGACTTTTTGAGG + Intronic
918091174 1:181296341-181296363 AATTCAGGGTCTAATTTGTGGGG + Intergenic
918278211 1:182975182-182975204 ACTTAGAGGTGGAATTTCTGGGG - Intergenic
918374446 1:183895087-183895109 CCATCAGGGTTGAATTTCTGGGG - Intronic
919791127 1:201291660-201291682 GCTTCTGGGTGGAAAATTTGGGG - Intronic
920595898 1:207269618-207269640 ACTTCAGGGTGGAAGTTGGGAGG - Intergenic
923112594 1:230904198-230904220 ACTTTAGTGTGGAATTTCTTTGG - Intergenic
923157514 1:231291631-231291653 ACTTCAAGGTAGAGTTTCTGAGG - Intergenic
923968482 1:239171731-239171753 ACTTTAGGTTTGACTTTTTGAGG - Intergenic
924379591 1:243449978-243450000 CTTTCAGGGTGGGATTTTTGAGG + Intronic
924440873 1:244084097-244084119 ACTTCAAGGAGGAAGTTTTTTGG - Intergenic
1062982100 10:1733503-1733525 ACTTCAGGGTAGTATGTATGAGG - Intronic
1066091055 10:32020851-32020873 AATTCCAGGTGAAATTTTTGAGG - Intronic
1067007577 10:42679578-42679600 TCTTGAGGGTGGGAGTTTTGAGG - Intergenic
1068743178 10:60498334-60498356 ACTTCAAGCTTGAAGTTTTGTGG - Intronic
1069708681 10:70475421-70475443 CCTTCAGGGTGGGAGTCTTGTGG - Intergenic
1071144871 10:82556787-82556809 ACTTCAGGGTGGAGGCTTGGAGG - Intronic
1072860408 10:98998057-98998079 ACTTCAGGAAGGAATGTTTTGGG - Intronic
1073998973 10:109348367-109348389 ACTGCAGGGGAGAATTTTTGGGG - Intergenic
1074411745 10:113234622-113234644 AATTCAAGATGAAATTTTTGTGG - Intergenic
1074936590 10:118188029-118188051 TATTCAGGGTGGTATTTCTGAGG + Intergenic
1075480168 10:122774077-122774099 AATTCATGGTGAATTTTTTGTGG + Intergenic
1077764429 11:5142891-5142913 TCTTGATAGTGGAATTTTTGAGG + Intergenic
1077812400 11:5651393-5651415 ACTTGAGGGTGGAGGTTTAGAGG - Intergenic
1078275346 11:9839655-9839677 CCTTCAGGGTGGTACTTGTGGGG + Exonic
1079449739 11:20589506-20589528 ACTTCAGGTTGGGAGGTTTGGGG - Intergenic
1081425510 11:42922040-42922062 ACTTCAGGGTGGAGGGTTGGAGG - Intergenic
1082268132 11:50141794-50141816 ACTTCAAGTTGAAATTTTTATGG - Intergenic
1083770834 11:64866372-64866394 ACTTGAGGGTGGAATGGGTGAGG + Intronic
1084299546 11:68238170-68238192 ACTTCAGAGTGGAAACCTTGTGG + Intergenic
1087143632 11:94790643-94790665 ACTTCAGGGTGGAATTTTTGTGG - Intronic
1088355150 11:108935161-108935183 ACCTCAAGGTGGAATCCTTGAGG + Intronic
1091179774 11:133593860-133593882 AATTAAGTGTGGAATTTTGGCGG + Intergenic
1091546552 12:1504911-1504933 ACCGCAGGGTGGAAATTGTGGGG + Intergenic
1092420120 12:8324181-8324203 ACTCAGAGGTGGAATTTTTGTGG + Intergenic
1093498432 12:19783354-19783376 ACTTGAGGGTGGAATGTGGGAGG + Intergenic
1095323996 12:40864847-40864869 AATTAAGGGTGGAATTGCTGGGG + Intronic
1098691639 12:73496971-73496993 ACTTCAGGGTGGCTTTGTTTAGG - Intergenic
1099471108 12:83049308-83049330 ACTTGAGGGTGGAAGTTGGGAGG - Intronic
1100213497 12:92423119-92423141 ACTTCATGCTGGAATATTTTTGG + Intronic
1101448781 12:104757332-104757354 ACTTCTGGGTGAACTTGTTGCGG - Exonic
1102968311 12:117146360-117146382 CCTTCCAGGTGGCATTTTTGGGG + Intronic
1103627073 12:122227368-122227390 GCTTCAGGGTGGAAGATTCGTGG - Exonic
1106114161 13:26802418-26802440 ACATCAGGGTATACTTTTTGGGG + Intergenic
1108915910 13:55610931-55610953 ATTAAAGGGTGGAATATTTGAGG - Intergenic
1109522999 13:63536480-63536502 ACTTCAGCATGGCATTTATGGGG - Intergenic
1110530719 13:76594527-76594549 ACTTGAGGGTGGAGATTGTGAGG - Intergenic
1111502776 13:89144679-89144701 ACTACATGTTGGAACTTTTGGGG + Intergenic
1111638062 13:90931157-90931179 ACTTGAGGGTGGAAGTTGTGAGG + Intergenic
1112365988 13:98755901-98755923 TCTGCAGGGTGGTATTTCTGTGG + Intergenic
1115716660 14:36113253-36113275 ATTTCAAGGTGGGATTTTTTGGG - Intergenic
1116043503 14:39714850-39714872 ACTTCAGAGAGAAATATTTGAGG + Intergenic
1116719102 14:48469960-48469982 AATTCAGTGTGTAATGTTTGGGG - Intergenic
1117407428 14:55417773-55417795 TCTTCAGGCTGTAATTTCTGGGG + Intronic
1118215037 14:63800804-63800826 ACTTGAGGGTGGAATCTGGGAGG + Intergenic
1120053289 14:79893422-79893444 ATTTCTGGGGGGAATTTTGGGGG + Intergenic
1120343408 14:83251454-83251476 ACTTCACTGTGCAATTTATGTGG - Intergenic
1120368891 14:83607300-83607322 ACTTTTGGATGGAATTTTTGTGG + Intergenic
1125115823 15:36090500-36090522 GCTTAAGTGTAGAATTTTTGAGG + Intergenic
1125452699 15:39825736-39825758 GCTGCAGGCAGGAATTTTTGGGG - Intronic
1128131531 15:65230435-65230457 ACTTGAGCCTGGGATTTTTGAGG - Intergenic
1128824725 15:70703154-70703176 AATTCAGGGTGGTTTTTTTGTGG + Intronic
1129042721 15:72703959-72703981 ACTACAGGGGAGAATTCTTGAGG + Intronic
1130928647 15:88404216-88404238 ACCTCTGGATGGAAGTTTTGGGG - Intergenic
1132158456 15:99514166-99514188 TCTTCAGGGTGGATCTTTGGGGG + Intergenic
1132392977 15:101452502-101452524 ACTTTAGACTGGAATTTTTCAGG - Intronic
1135484539 16:22852553-22852575 GCTTGAGGGAGGAATCTTTGGGG - Intronic
1136031150 16:27504044-27504066 GCTTCAGGGTGAAAAGTTTGGGG + Intronic
1143617207 17:8059430-8059452 ACTCCAGTGGGGACTTTTTGAGG - Intergenic
1143698834 17:8642072-8642094 AATTCAGGGTGAGATTTTAGTGG - Intergenic
1144129704 17:12234350-12234372 TATTCAGCGTGGAACTTTTGGGG + Intergenic
1148892873 17:50820448-50820470 ATTTCATGGTGGAATGATTGGGG - Intergenic
1149458028 17:56804958-56804980 TCTCCAGGGTAGAAATTTTGTGG - Intronic
1151859884 17:76752611-76752633 ACTTGAGGGTGGATTACTTGAGG - Intronic
1152386087 17:79975627-79975649 ACTTCAGGGTGGACCTGTTGTGG - Intronic
1155866426 18:30971612-30971634 ACTGCAGTGTGGCACTTTTGAGG - Intergenic
1156212424 18:34959629-34959651 ACTTTAAGGTGGAATGGTTGAGG - Intergenic
1156656795 18:39298068-39298090 ACTTTAGGGTGAAATGTTTTGGG - Intergenic
1156685099 18:39635219-39635241 ACTTCTGGGTGGAAGTTTCAAGG + Intergenic
1158023200 18:52868338-52868360 ACTTCTGGGAGTAATTTTTTGGG - Intronic
1159296318 18:66494074-66494096 ACTCCATGGTGGAATTTCTATGG - Intergenic
1161436924 19:4268981-4269003 ACTTCAGGGTGGCAGTGTTTGGG + Exonic
1161763468 19:6191686-6191708 ACTTCAGGGTGTAACTTATTTGG - Intronic
1161835271 19:6641736-6641758 ACTTCAGTGTGTAAATTTCGGGG + Intergenic
1163712415 19:18854667-18854689 ACTTCCAGGTGGATTTTGTGTGG + Exonic
1165523160 19:36330278-36330300 ACTCAGAGGTGGAATTTTTGTGG + Intergenic
925493172 2:4418424-4418446 ACTTGAGGGTGGAGTTTGGGAGG + Intergenic
925542949 2:4985979-4986001 AATTAAAGGTGGAATTTTGGTGG - Intergenic
925884157 2:8380155-8380177 ACTTCATGGGGGAACTTCTGTGG - Intergenic
926190339 2:10722971-10722993 ACTTCAAGGTAAAATTCTTGGGG + Exonic
926210704 2:10867542-10867564 ACTTCAGCGTATGATTTTTGGGG + Intergenic
929425095 2:41836753-41836775 ACTTGAGGGTGGAAATATTCTGG - Intergenic
929988584 2:46764177-46764199 GGTTTGGGGTGGAATTTTTGTGG + Intergenic
931546759 2:63396810-63396832 ACTTGAGGGTGGAGTTTGGGAGG - Intronic
932511483 2:72297373-72297395 ACTTGAGGGTGGAACGTGTGAGG - Intronic
935625087 2:105165692-105165714 AATTCTGCGTTGAATTTTTGAGG + Intergenic
935948438 2:108306958-108306980 TCTTGGGGGTGGAGTTTTTGTGG - Intronic
937102316 2:119281269-119281291 ACTTGAGGGTGGAAGTTGGGAGG - Intergenic
937441951 2:121923269-121923291 ACTTGAGGGTGGAGGTTTAGAGG - Intergenic
937673215 2:124560927-124560949 AGTTCAGGGTTGACTTTTTTTGG - Intronic
937687794 2:124717759-124717781 AATTGAGGATGGAATTTTTATGG + Intronic
939022849 2:136979932-136979954 ACTTTTGGCTGGCATTTTTGTGG + Intronic
941680967 2:168398995-168399017 ACAACATGGTGGAATTTTTGTGG - Intergenic
942911638 2:181251568-181251590 CCATGAGGGTGGAATCTTTGTGG - Intergenic
942994107 2:182240114-182240136 TGTTCAAGCTGGAATTTTTGTGG - Exonic
943892721 2:193310999-193311021 ATTTAAGAGTGGAAATTTTGGGG - Intergenic
943985056 2:194607409-194607431 ACTTCAGGGTGGAGTCCTTGGGG - Intergenic
945597660 2:211815542-211815564 ACTTAAAAGTGGAATATTTGAGG - Intronic
946516524 2:220417486-220417508 ACTTCATGGTGGAATGCTGGGGG + Intergenic
946815182 2:223569845-223569867 TCTTCCTGGTGGAGTTTTTGAGG - Intergenic
947597488 2:231422423-231422445 ACTTCAGCGTGTGAATTTTGAGG + Intergenic
1169140571 20:3225262-3225284 ACATCAGTGTGGAGTTTCTGAGG - Intergenic
1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173457363 20:43214462-43214484 AATTCAGGGTGAAATTTGGGTGG - Intergenic
1173521644 20:43704386-43704408 ACTTCAGGATGTAAATTTGGGGG + Intronic
1173547440 20:43909796-43909818 ACTTCCAGGTGGAAGTTTTAAGG - Intergenic
1174388122 20:50198691-50198713 TCTTCAGGGTGGGATTGGTGAGG + Intergenic
1175627059 20:60497790-60497812 ACTCTAGGGTGACATTTTTGGGG - Intergenic
1177227350 21:18274763-18274785 AATTCAGGGTTGAAATTTAGAGG + Intronic
1179035672 21:37756999-37757021 ACTCCAGGCTCGAATCTTTGAGG - Intronic
1181524490 22:23472411-23472433 ACTGGAGGGTGGAAGTTTGGAGG + Intergenic
1181788461 22:25244368-25244390 ACTTCTGCGTGGGATTTTTAGGG - Intergenic
1182193480 22:28489412-28489434 CTTTCAGGGTGAGATTTTTGAGG - Intronic
1184888563 22:47365091-47365113 ACTTCTGTTTGAAATTTTTGAGG + Intergenic
1185211287 22:49571932-49571954 TCTTCATGGTGGGATTTTAGGGG - Intronic
949917319 3:8975177-8975199 ACTCCAGGCTGGGATTTGTGGGG - Intergenic
950421773 3:12903688-12903710 ACTTCTCCGTGGATTTTTTGAGG + Intronic
950775866 3:15349810-15349832 ACTTGAGGGTGGAAGTTGGGAGG + Intergenic
951303041 3:21022059-21022081 ACTTCAGAGTGCACTTTCTGGGG - Intergenic
952217908 3:31295911-31295933 TATTCAGTGTGGAATTTTTGAGG - Intergenic
952262670 3:31755517-31755539 ACTTCATGGTGTCATTATTGAGG + Intronic
952574755 3:34760882-34760904 ACTTCAGGGTGTTTTTTTAGTGG - Intergenic
953093089 3:39749128-39749150 ACGTAAGGGTAGAATTTCTGGGG - Intergenic
953249824 3:41234775-41234797 GCTTCAGGTTGAGATTTTTGTGG - Intronic
955567574 3:60264785-60264807 ACTTAAGGAAGGAATTTTTAAGG + Intronic
956736793 3:72244580-72244602 ACTTCAGGGAGGGGTTCTTGAGG - Intergenic
957064062 3:75506726-75506748 ACTCAGAGGTGGAATTTTTGTGG + Intergenic
957882353 3:86235739-86235761 AAATCTGTGTGGAATTTTTGTGG + Intergenic
958127460 3:89375632-89375654 ACTTTAGGCTGGAAGTCTTGGGG - Intronic
959496698 3:107060099-107060121 ACTCCAGGGTAGAATTTAGGTGG + Intergenic
960615170 3:119589764-119589786 AGTTTGGGGTGGAAGTTTTGAGG - Exonic
961289288 3:125832657-125832679 ACTCAGAGGTGGAATTTTTGTGG - Intergenic
961897802 3:130183373-130183395 ACTCAGAGGTGGAATTTTTGTGG + Intergenic
961953415 3:130773912-130773934 ACTTCCTGGTGGAATTTTAAAGG + Intergenic
963305335 3:143645417-143645439 ACTTCAGTGAGGAGTTATTGAGG + Intronic
965742728 3:171892989-171893011 ATTTCAAGTTAGAATTTTTGAGG - Intronic
966743686 3:183255243-183255265 AGTTCAGGGTGGAATCATTTCGG - Intronic
969343026 4:6554088-6554110 ACTTCAATGTGAATTTTTTGTGG - Intronic
969745649 4:9069114-9069136 ACTCAGAGGTGGAATTTTTGTGG - Intergenic
969805008 4:9600565-9600587 ACTCAGAGGTGGAATTTTTGTGG - Intergenic
970430005 4:15980474-15980496 ACTTCCGGCTCTAATTTTTGCGG - Exonic
972970385 4:44567442-44567464 ACTTGAGGGTGGAAGTTGGGAGG + Intergenic
974091223 4:57313516-57313538 ATTTCAGGGTGAAATGATTGAGG - Intergenic
975116590 4:70687765-70687787 AATTCAGGGTGTAAGTTTTTAGG - Intergenic
976452246 4:85203587-85203609 ACTTCAGTGTGTATTTTTAGTGG - Intergenic
977135222 4:93295520-93295542 ATGGCAGGCTGGAATTTTTGGGG + Intronic
977482848 4:97600083-97600105 ACTTGAGGGTGGAAGGTTGGTGG + Intronic
978045126 4:104115778-104115800 AATTCAGGGTGGGATTTGGGTGG + Intergenic
978332563 4:107630315-107630337 AATTCAAGATGGAATTTGTGTGG - Intronic
979687850 4:123530299-123530321 TCTACAGGGTGAAATTTTTAAGG + Intergenic
979722117 4:123912871-123912893 ACTTCAGGGCAGTTTTTTTGTGG - Intergenic
979883246 4:125988841-125988863 ACTTCAGGGTGGAGTTTGAGAGG - Intergenic
980722482 4:136716616-136716638 ACTTCAAGCCTGAATTTTTGTGG + Intergenic
980771637 4:137380666-137380688 ACTTCATGGTGGATTTGTTGTGG - Intergenic
981310587 4:143294341-143294363 GTTGCAGGGTGGAATGTTTGTGG + Intergenic
981482317 4:145251669-145251691 ACTTCTGGGAAGAATTTCTGTGG - Intergenic
981854562 4:149272599-149272621 TCCTCACGGTGGAATTTTCGAGG + Intergenic
982663801 4:158236037-158236059 ACTTTAGGGTGTTTTTTTTGTGG + Intronic
984112204 4:175630511-175630533 ACTTCATAGTGGATTTTTAGTGG + Intergenic
985032290 4:185801362-185801384 AGTTCTGGTTGTAATTTTTGAGG + Intronic
985040594 4:185887860-185887882 ACTTAAGGGGGAAAGTTTTGAGG - Intronic
986864918 5:11974801-11974823 AATTCAAGGTGAGATTTTTGTGG + Intergenic
987059294 5:14226748-14226770 ACTTCAGGGTGGAGCCTTTCAGG - Intronic
987794178 5:22606384-22606406 AATTCAAGGTGAGATTTTTGTGG - Intronic
988666845 5:33338319-33338341 ACTTCTGGGTGGATTCTTTCAGG + Intergenic
988966727 5:36426065-36426087 ACCTGAGGGTGGAGTTTTGGAGG - Intergenic
990199495 5:53355338-53355360 ACTTCATGGTTTATTTTTTGTGG - Intergenic
990705280 5:58521631-58521653 AATTGAGGGTGGAAGTTTGGAGG - Intergenic
990738777 5:58891359-58891381 ATTTCAGGCTGGATTTTATGTGG + Intergenic
990898216 5:60722667-60722689 ACTTGAGGGTGGAAGGTTGGGGG + Intergenic
992886408 5:81164690-81164712 ATTTAGGGGTGGAATTCTTGGGG + Intronic
992906443 5:81350803-81350825 TCTGGAGGGTGGAATTTTTCTGG + Intronic
993241929 5:85400353-85400375 ACTTCAGGCTGAAATTATTGGGG + Intergenic
993575533 5:89595120-89595142 ACTTTAGTGAGGAATTTTTATGG - Intergenic
993938062 5:94027260-94027282 ACATCAGGTAGGAATTTCTGAGG - Intronic
994480459 5:100327773-100327795 ACTTCTTGATGGGATTTTTGGGG + Intergenic
995501377 5:112810741-112810763 ATTTCAGGTTGGATTTCTTGTGG - Intronic
997092818 5:130877376-130877398 AATTCAAGATGAAATTTTTGTGG - Intergenic
998797955 5:145838680-145838702 ACTTGAGGGTGGAAATTTGCTGG + Intergenic
1001878408 5:175220881-175220903 ACTTAAGAGTGGAATTCTTGGGG - Intergenic
1002001336 5:176197893-176197915 ACTTACGGGTGCAAGTTTTGGGG - Intergenic
1002089978 5:176798656-176798678 ACTTCAGGGTGGGATCTTGGAGG - Intergenic
1003848460 6:10198070-10198092 ATTTCAGGATGCAATTTTTTAGG + Intronic
1007284946 6:40740969-40740991 CCTCCAGGGTGGAACCTTTGTGG + Intergenic
1007613685 6:43167513-43167535 AGGTCAGGGTGGAATCTGTGTGG + Intergenic
1009452341 6:63816681-63816703 TCTTCAGGGTGCAAATCTTGGGG + Intronic
1009818770 6:68772366-68772388 ATTTCAGATTTGAATTTTTGAGG + Intronic
1010143853 6:72643104-72643126 ACTTGAGGGTGGAAGTTGGGAGG + Intronic
1010326956 6:74575500-74575522 ACTTGAGGGTGGAAGTTGAGAGG - Intergenic
1010771805 6:79840479-79840501 ACTCCTGGGTGGAAGTTTTAAGG - Intergenic
1011978078 6:93333031-93333053 ACTTGAGGGTGGAGTTTTGGAGG - Intronic
1012238886 6:96850003-96850025 ACTTCAGGGTGGAGGTTGAGAGG + Intergenic
1012310655 6:97720252-97720274 ACTTCAGGATGCCATTCTTGAGG - Intergenic
1014899272 6:126943514-126943536 ATTTCAGGGTGAAGTGTTTGGGG + Intergenic
1015647301 6:135407209-135407231 GGTTTAGGGTGTAATTTTTGTGG - Intronic
1015678673 6:135780341-135780363 ACACCAGGGTGGGATTTTTGTGG + Intergenic
1017853165 6:158323703-158323725 ACATCATGGTTGAATGTTTGTGG + Intronic
1023198446 7:37667297-37667319 CCTTCAGGGAGGAAACTTTGAGG + Intergenic
1023612531 7:41985653-41985675 ATTTCAGGCAGGAAGTTTTGAGG - Intronic
1023744012 7:43305032-43305054 AGTTCAGAGTGGAAGCTTTGGGG + Intronic
1025064871 7:55845066-55845088 ACTTGAGGGTGGAGGTTTGGAGG - Intronic
1027832421 7:83196467-83196489 ACTTCAGAGAGGGATTTTGGAGG + Intergenic
1028166780 7:87547334-87547356 ACTTTAGGGTGTAAATTTTGAGG - Intronic
1028605648 7:92652540-92652562 TTTTCAGGGGGGAATTTCTGAGG + Intronic
1032000310 7:128260810-128260832 ACTTCAGGATGGAACAATTGAGG + Intergenic
1032003788 7:128284042-128284064 TTTTCAAAGTGGAATTTTTGGGG - Intergenic
1032988304 7:137362814-137362836 AATTCAAGGTGAAATTTTGGTGG + Intergenic
1036058992 8:5293921-5293943 ATTTTTGGGTGAAATTTTTGGGG + Intergenic
1037772101 8:21808228-21808250 ACTCCATGGTGGAATATTTAAGG + Intronic
1039177171 8:34822619-34822641 AGTTGAGCCTGGAATTTTTGTGG - Intergenic
1040703401 8:50095150-50095172 ACTTCAGGGTGGAAAGTGGGAGG + Intronic
1041661821 8:60408339-60408361 ACACCAGGTAGGAATTTTTGAGG - Intergenic
1043938134 8:86166708-86166730 ACTTAAATGTGGAACTTTTGGGG + Intergenic
1044885950 8:96777576-96777598 ACTTCAGTGTGAAACTTTTAGGG - Intronic
1045547946 8:103144634-103144656 GCTTAAGGATGCAATTTTTGGGG - Intronic
1046700023 8:117389890-117389912 ACTTCATGGTTGACATTTTGGGG - Intergenic
1050238381 9:3607783-3607805 ACTTGAGGGTGGAGTTTGGGAGG - Intergenic
1053464456 9:38295189-38295211 ATTTCAGGGTGGAATTATCAGGG + Intergenic
1055673960 9:78636099-78636121 ACTTCATGGTGGGAACTTTGTGG - Intergenic
1056428553 9:86503753-86503775 ATTTCAGAGTGGAGTTTTAGTGG + Intergenic
1186081451 X:5937807-5937829 ACTTCAGGGTGAAATACATGTGG - Intronic
1187580806 X:20605375-20605397 AACTCAGGGTTGAATATTTGAGG + Intergenic
1188308909 X:28593049-28593071 ACTCCAGGGTGGCATTTTCTGGG - Intronic
1188897699 X:35689039-35689061 ACTTGATGGTGGGTTTTTTGAGG + Intergenic
1188919755 X:35958389-35958411 ACCTAAGAGTGGAATTGTTGGGG + Intronic
1192486957 X:71535709-71535731 ATTTCAGGTTGGATTTGTTGAGG - Intronic
1193294049 X:79813142-79813164 ACTTGAGGGTGGATGTTGTGGGG - Intergenic
1193397168 X:80999258-80999280 ACTTGAGGGTGGCAGATTTGAGG + Intergenic
1194106879 X:89780435-89780457 AATTCACGGTGAAATTTGTGTGG + Intergenic
1194145460 X:90256092-90256114 AATTCAAGGTGGGATTTGTGTGG + Intergenic
1194320193 X:92436811-92436833 CCTTGAGGGTGGAGTTTTGGAGG + Intronic
1194529689 X:95030304-95030326 ACTTAAGGGTGGATTTTAGGAGG + Intergenic
1195488663 X:105440751-105440773 AATTCAAGGTGAAATTTTGGTGG - Intronic
1195724217 X:107897306-107897328 GCTTCAGTGTGTAATTTTTTTGG - Intronic
1196354630 X:114776121-114776143 TATTCAGGATGGAATCTTTGAGG - Intronic
1197498880 X:127220095-127220117 ACTTGAGGGTGGAAAGTTGGAGG - Intergenic
1197649938 X:129053483-129053505 AGTGCAGTATGGAATTTTTGAGG - Intergenic
1198122249 X:133605801-133605823 AAGCCTGGGTGGAATTTTTGTGG + Intronic
1198623895 X:138546622-138546644 ACTTCTGGGTGGATATTTTTAGG + Intergenic
1199564239 X:149197771-149197793 ACTTCAGTGTGTTATTTTAGTGG + Intergenic
1199954853 X:152734695-152734717 ACTTCAGGGTGACAGATTTGCGG + Intronic
1200458841 Y:3428300-3428322 AATTCACGGTGAAATTTGTGTGG + Intergenic
1200491215 Y:3825390-3825412 AATTCAAGGTGGGATTTGTGTGG + Intergenic
1200628315 Y:5549943-5549965 CCTTGAGGGTGGAGTTTTGGAGG + Intronic