ID: 1087150919

View in Genome Browser
Species Human (GRCh38)
Location 11:94858914-94858936
Sequence AGCAGAAGACCTCTAGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087150919_1087150922 26 Left 1087150919 11:94858914-94858936 CCTTATGCTAGAGGTCTTCTGCT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1087150922 11:94858963-94858985 TCATTCTCAGGCCTCTGAGTGGG 0: 1
1: 0
2: 0
3: 23
4: 205
1087150919_1087150920 14 Left 1087150919 11:94858914-94858936 CCTTATGCTAGAGGTCTTCTGCT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1087150920 11:94858951-94858973 CTAGTTTGATTCTCATTCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 180
1087150919_1087150923 27 Left 1087150919 11:94858914-94858936 CCTTATGCTAGAGGTCTTCTGCT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1087150923 11:94858964-94858986 CATTCTCAGGCCTCTGAGTGGGG 0: 1
1: 0
2: 2
3: 20
4: 221
1087150919_1087150921 25 Left 1087150919 11:94858914-94858936 CCTTATGCTAGAGGTCTTCTGCT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1087150921 11:94858962-94858984 CTCATTCTCAGGCCTCTGAGTGG 0: 1
1: 0
2: 3
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087150919 Original CRISPR AGCAGAAGACCTCTAGCATA AGG (reversed) Intronic
906204064 1:43977893-43977915 AGAAGATGACATCTAGCACATGG - Intronic
908496782 1:64702189-64702211 AGAAGGAGACATCAAGCATAGGG - Intergenic
910366022 1:86466353-86466375 ACCAGATGACCTCTGTCATAGGG + Intergenic
917645816 1:177027671-177027693 AGGAGAAGAAGTCTAGGATAAGG - Intronic
917896804 1:179498634-179498656 AACAGAAAACCTCCAGAATAGGG + Intronic
917904274 1:179574130-179574152 AGCAGGAGACCTCAAGCAATGGG - Intronic
918391531 1:184068441-184068463 AGCAGCAGATTTCTAGCAGAGGG - Intronic
918980164 1:191547186-191547208 AGCAGAAGAGTTCTTCCATAAGG + Intergenic
919364304 1:196637809-196637831 AGAAGAATCCTTCTAGCATAAGG - Intergenic
921131167 1:212221270-212221292 AGGTGCTGACCTCTAGCATAGGG + Intergenic
923795038 1:237145479-237145501 ATCAGAAAAACTCTTGCATATGG - Intronic
1064110411 10:12533998-12534020 TGCAGAAGAACTCTTGCAAAGGG - Intronic
1064800566 10:19065705-19065727 AACAGAAGACCTGGAGCACATGG - Intronic
1065827139 10:29582876-29582898 AGAAGAAGACCTCATGCAGAGGG + Intronic
1065950714 10:30648292-30648314 AGAAGAAGACCTCATGCAGAGGG - Intergenic
1069611264 10:69774166-69774188 AGGAGAAAACTTCTAGCATATGG - Intergenic
1069617277 10:69814104-69814126 ATCAAAAGGCCTCTAGCAGATGG + Intronic
1071361110 10:84846802-84846824 AGCAGTAGAGCTCTAGCAGTGGG + Intergenic
1075827975 10:125376781-125376803 AGCAGTAGACCTCTAACTAAAGG + Intergenic
1087083780 11:94196824-94196846 AGCAGAAGACAGCTAGGAGAAGG + Intergenic
1087150919 11:94858914-94858936 AGCAGAAGACCTCTAGCATAAGG - Intronic
1088519136 11:110675746-110675768 AGTAGGAGTCCTCTAGCACAGGG - Intronic
1088977286 11:114827062-114827084 AGAAGAAAACCACTAGCACAGGG + Intergenic
1089990694 11:122856942-122856964 AGCAGTAGAACTGAAGCATAGGG + Intronic
1090154942 11:124427401-124427423 ATCAGAAAACATCCAGCATAAGG - Intergenic
1099712476 12:86244845-86244867 AGCAGCAGAACTGAAGCATAGGG + Intronic
1101532058 12:105582284-105582306 AGCTGAAGACCCCCAGCAGAAGG + Intergenic
1103382471 12:120505153-120505175 AGCAGAATGCCTATAGCATTTGG - Intronic
1106609077 13:31261226-31261248 AGCAGAAACCCTCAAGCATCTGG - Intronic
1106727347 13:32499535-32499557 AGAAGAAGACTTCTAGCTTTTGG - Intronic
1106909591 13:34449245-34449267 GGCAGTAGCCCTTTAGCATAAGG + Intergenic
1108061238 13:46535460-46535482 AGTAGAAGAGCTCTAGAATTAGG - Intergenic
1109389262 13:61671364-61671386 GGCAGAAGCCCTTTAGCAGACGG - Intergenic
1114624609 14:24120734-24120756 AGCAGAAGAACTCTGGCCTCTGG - Intronic
1117884676 14:60348086-60348108 AGAAGAAAACATCTAGAATATGG + Intergenic
1119575193 14:75714262-75714284 AGCAGATGACCTAAAGCAAATGG - Intronic
1119953169 14:78766976-78766998 AGCAAAAGAAAACTAGCATAGGG - Intronic
1119989225 14:79176405-79176427 CACAGAAAACCTCTAGCCTATGG + Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1129181570 15:73881351-73881373 AGCCGAAGCCTTCTAACATAAGG + Intronic
1137979382 16:53056386-53056408 CACAGAAAGCCTCTAGCATAGGG - Intronic
1138138477 16:54545512-54545534 AGGAGAATATTTCTAGCATAAGG + Intergenic
1139404180 16:66705276-66705298 AGCAGAAGATTTCAAGCATAAGG + Intergenic
1139508571 16:67412748-67412770 ACCACAAGTCCTCTAGCAAAAGG - Intronic
1147840302 17:43366892-43366914 AGCAGTAGAGCTCTAGGATCAGG + Intergenic
1152415958 17:80162098-80162120 AGCAGAAGACCTCCAACCAACGG + Intergenic
1156252615 18:35365484-35365506 ATCAGAAGTCCTCTAGCCTTTGG - Intergenic
1156994955 18:43454001-43454023 AGCAGAACATCTATGGCATAGGG - Intergenic
1158376524 18:56876049-56876071 AGCTGAAGACTTCTAACCTATGG - Intronic
1165178725 19:33949244-33949266 AGCAGCAAATCACTAGCATACGG - Intergenic
1165206303 19:34190387-34190409 TGAAGAAAACCTCTATCATATGG - Intronic
1167773207 19:51535845-51535867 AGGAGAAGACCTTTTGCATTGGG + Intergenic
925508093 2:4592132-4592154 TGCAGAAGACCACCAGCATCTGG - Intergenic
926793805 2:16602197-16602219 ATAAGAAGACCTCTATCAGAAGG + Intronic
930216285 2:48700731-48700753 AGAAAAAGACCCCTAGGATAAGG + Intronic
935313194 2:101805806-101805828 TGCAGAAGACCTGTAGCAGCTGG - Intronic
937727541 2:125185827-125185849 ACCAGAAGCCCTCTAGCGGAGGG - Intergenic
940688189 2:156880577-156880599 AGCAGAAGAGATGTAGCATGTGG + Intergenic
941988794 2:171534651-171534673 GGCAGGTGACCTCTAGCACATGG - Intronic
944559914 2:200925893-200925915 AGAAGAAGTCCTCGATCATATGG - Exonic
944621437 2:201519497-201519519 AGTAACAGACCCCTAGCATAAGG + Intronic
1172827480 20:37802716-37802738 AGGAGAAGACGTCTACAATAGGG - Intronic
1174132349 20:48354853-48354875 AGCAGAAGGCCGTTAGCCTAAGG - Intergenic
1177430225 21:20982978-20983000 AGCAGAGGACCTCAGGAATATGG + Intergenic
1178641175 21:34345704-34345726 ACCGGAAGACTTCCAGCATATGG - Intergenic
1181625758 22:24121136-24121158 AGCAGGAGACCTCTAGGAGGAGG - Intronic
960163733 3:114378594-114378616 AACAGAAGATTTCTAGCCTAAGG + Intronic
960841992 3:121968555-121968577 AGCAGAATTTCTCTATCATATGG + Intergenic
969101986 4:4776298-4776320 GGAAGAAGACCTTTAGCAAAGGG - Intergenic
970881355 4:20935979-20936001 ATCACAAGACCTCTATCATTAGG - Intronic
971603181 4:28622565-28622587 AGCAGAAGACATTCTGCATAAGG - Intergenic
972866935 4:43244352-43244374 AGCAGAAGACCTCTTGGGTTAGG - Intergenic
975914055 4:79301676-79301698 AGCAGAAGAGCTCCAGCATGGGG + Intronic
981579413 4:146236874-146236896 TGCAGAAGACATCTATCATCAGG - Intergenic
994587654 5:101730361-101730383 AACAGAAGACATCTGGCACATGG + Intergenic
994656617 5:102602163-102602185 AGCAGAAGACTTGCAGCAGAGGG + Intergenic
997657167 5:135564033-135564055 TGCAGAAAACCCCTAGCATCTGG + Intergenic
1012785587 6:103621439-103621461 AGCAGAAAACATGTAGAATAAGG - Intergenic
1015109015 6:129569850-129569872 AGCAGCAGACCTGCAGCAGAGGG + Intergenic
1015610729 6:135015304-135015326 ACCAAATGACCTCTAACATATGG - Intronic
1016720700 6:147294054-147294076 ACCAGATGTTCTCTAGCATAGGG + Intronic
1018401341 6:163423551-163423573 AGCAGCAGATTTTTAGCATATGG - Intronic
1019837201 7:3399959-3399981 AGGAGAAGCCCTCTACCCTAGGG - Intronic
1022325613 7:29328775-29328797 AGCATTTGACCTCCAGCATAAGG - Intronic
1023113657 7:36839337-36839359 ATCAGAAGACCTAGAGCATGAGG - Intergenic
1024139537 7:46447807-46447829 AGCAGAGGACCTCTGGCCTTGGG - Intergenic
1031507628 7:122606305-122606327 AGCAGAAGACCTTTAGGAAAGGG + Intronic
1032287160 7:130547999-130548021 AACAAAAGACCTCAAGAATAAGG - Intronic
1046063032 8:109162231-109162253 AGCAGAAGCCAACTAGCAGAAGG + Intergenic
1047973415 8:130106730-130106752 AGCAGAACTCCTCAAGGATAAGG - Intronic
1050637502 9:7627367-7627389 ACCAGCAGACCTGTAGCAGAGGG + Intergenic
1053018048 9:34675283-34675305 TGCAGAGGGCGTCTAGCATACGG + Intergenic
1059259718 9:112963891-112963913 AGAAGAAGACCATTAGCACAAGG - Intergenic
1203654864 Un_KI270752v1:13948-13970 ACCAGCAAAACTCTAGCATATGG - Intergenic
1186682728 X:11892690-11892712 AGCAGCAGACCCCTAGGAAATGG - Intergenic
1186942382 X:14524309-14524331 ATGAGAAGACCTCTGGCATGAGG - Intergenic
1192202704 X:69077034-69077056 AGGAGAAGTCATTTAGCATAAGG - Intergenic
1195201066 X:102550473-102550495 AGCAAAAGTCCTTTAGCACAGGG - Intergenic
1200780979 Y:7215346-7215368 AGCAGAAAATCTCAAGCAGATGG - Intergenic