ID: 1087151341

View in Genome Browser
Species Human (GRCh38)
Location 11:94862187-94862209
Sequence CAGACTACCCCTTCTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087151341 Original CRISPR CAGACTACCCCTTCTGGGTG GGG Intronic
900371571 1:2334478-2334500 CTTACTACGTCTTCTGGGTGCGG - Intronic
900557790 1:3288839-3288861 CAGGCTGCCCCTTCTGGGGGAGG + Intronic
903826314 1:26148088-26148110 GAGACTACCACAGCTGGGTGCGG + Intergenic
903862373 1:26372507-26372529 CGGGTCACCCCTTCTGGGTGGGG - Intronic
905227532 1:36488976-36488998 CAGGCCACCCCTTCAGGGTCTGG - Intergenic
905281148 1:36850205-36850227 CAGCCTCCATCTTCTGGGTGGGG + Intronic
905346274 1:37313142-37313164 CAGACAGCCCCTCCTGGGTGGGG - Intergenic
906577828 1:46906669-46906691 CAAAGGACACCTTCTGGGTGGGG + Intergenic
906941124 1:50256412-50256434 CAGACTTCCCCTTCAGGATCAGG - Intergenic
908026052 1:59952558-59952580 CAGTCTCCCCCTTCTGGGAAGGG - Intergenic
913437492 1:118862427-118862449 AAGAATTCCCCATCTGGGTGCGG + Intergenic
914894580 1:151657738-151657760 CACACTCCTCCTGCTGGGTGCGG + Intronic
923279150 1:232425593-232425615 CAGGCTCCCCATGCTGGGTGCGG + Exonic
1063974022 10:11401306-11401328 CTGACTGCCACATCTGGGTGGGG - Intergenic
1067912843 10:50364468-50364490 GAGACTAGCCCTTCTGGTTGGGG - Intronic
1069731927 10:70622668-70622690 GAGACTCACCCTCCTGGGTGGGG + Intergenic
1071251188 10:83821555-83821577 CAGATTACTCCTTGTGGGTGAGG + Intergenic
1071963074 10:90824916-90824938 CAGCCTTCCCCTTCAGGGAGTGG - Intronic
1077828473 11:5836520-5836542 CAAACTACCCCTGCTGGCAGAGG - Intronic
1078639337 11:13080661-13080683 CAGGCTGCCACTTCTGGGTCTGG + Intergenic
1078857198 11:15215813-15215835 GAGATGACCTCTTCTGGGTGAGG + Intronic
1079269715 11:18972699-18972721 CAGACTACCGTTTCTGAGCGTGG - Intergenic
1081985772 11:47302710-47302732 CAGTCTACCCCTTTTAAGTGAGG + Intronic
1087151341 11:94862187-94862209 CAGACTACCCCTTCTGGGTGGGG + Intronic
1091915036 12:4265829-4265851 CAGAATACGCCTTCTGTGTCTGG - Intergenic
1092290695 12:7158095-7158117 CAGAATTCCCCCTCTGCGTGGGG - Exonic
1097276226 12:57815340-57815362 CTGACTCCCCCTCCTGGTTGAGG + Intronic
1104413159 12:128576171-128576193 CAAACTCCCCCTTCTGGTTCAGG - Intronic
1104638850 12:130454538-130454560 CAGGCGACCCCTGGTGGGTGAGG + Intronic
1108409729 13:50133824-50133846 CCGCCTTCGCCTTCTGGGTGCGG + Intronic
1110756879 13:79185030-79185052 GAAACTACCTCTGCTGGGTGTGG - Intergenic
1112503290 13:99958029-99958051 CACACGACCCCTTGTAGGTGGGG - Intergenic
1118711955 14:68526916-68526938 CAGGCTTCCCCTTCTGGGTGTGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119331253 14:73795658-73795680 AAGTCTTCCTCTTCTGGGTGTGG + Intergenic
1120909835 14:89656306-89656328 GACACTACCCCTTTTGGGGGAGG - Intergenic
1121638710 14:95471256-95471278 CTGGCTGCTCCTTCTGGGTGTGG - Intronic
1121694897 14:95904488-95904510 CAGACCACTCTCTCTGGGTGAGG + Intergenic
1121731846 14:96192878-96192900 CTGAACACCCTTTCTGGGTGTGG + Intergenic
1121985197 14:98498553-98498575 CAGCCTTCCCCTTCCTGGTGAGG + Intergenic
1122268082 14:100556058-100556080 CAGGCCACCCCTCCTGGCTGAGG - Intronic
1123998880 15:25738078-25738100 CAGAGCACACCTTCTGGATGAGG + Intronic
1124008183 15:25811196-25811218 CAGCCTCCGCCTTCTGGGTCCGG - Intronic
1129944150 15:79524610-79524632 CAGATATCCCCTTCTGGGTCTGG + Intergenic
1130230212 15:82091256-82091278 CAGACATCCAATTCTGGGTGAGG + Intergenic
1133458535 16:5965760-5965782 CAGAGTAGCCGTTCTGAGTGTGG + Intergenic
1137808591 16:51330538-51330560 CAGTCTGCCCCTACTGGGGGAGG - Intergenic
1141517369 16:84554627-84554649 CAGCCTCCGCCTCCTGGGTGGGG - Intergenic
1142780412 17:2177083-2177105 CAGATTAACCCTTCAGGCTGAGG + Intronic
1142850798 17:2703867-2703889 CAGAGCACCCCTTCTGGAAGGGG - Intronic
1150208867 17:63430385-63430407 CAGACCATCCCTTCTGAGAGAGG - Intergenic
1151558470 17:74859013-74859035 CTGGCTTCCCCTCCTGGGTGGGG + Intronic
1151974773 17:77478361-77478383 CATAATTCCACTTCTGGGTGTGG + Intronic
1152343848 17:79739796-79739818 CAGTCCACTCCTTCTGGCTGGGG - Intronic
1152829362 17:82487666-82487688 AAGACTATCCCGGCTGGGTGCGG + Intronic
1161817642 19:6509648-6509670 CAGACTCTACCGTCTGGGTGGGG - Intergenic
1163338096 19:16686775-16686797 CTGAAGACCCCTCCTGGGTGGGG - Intronic
1164846233 19:31435110-31435132 CAGAATACTTCCTCTGGGTGAGG - Intergenic
1165563557 19:36703323-36703345 CAGTCTGCCCCTACTGGGGGGGG + Intronic
926759713 2:16267337-16267359 CAGACTGCCCATTCTGGGTCAGG - Intergenic
929609177 2:43257228-43257250 CAGACTACCTGTTTTGGGAGGGG + Intronic
929932489 2:46269679-46269701 CACCCTACTCCTTCTGGGAGAGG + Intergenic
935208206 2:100914968-100914990 CAGAGGCCCACTTCTGGGTGTGG - Intronic
935978691 2:108605286-108605308 CAGACTTCCCCTGCTGGGCAAGG + Intronic
943622780 2:190168287-190168309 CAGGCTACCCATGCTGTGTGTGG - Intronic
947959161 2:234220422-234220444 CATACCATCCCCTCTGGGTGAGG - Intergenic
948951077 2:241252209-241252231 CAGAATCCCCCTGCTGGGTGTGG + Intronic
1171143419 20:22762510-22762532 CAGACTGCCCCTTCCTGGGGTGG - Intergenic
1173177730 20:40777306-40777328 CAGGATTCCCCTCCTGGGTGGGG - Intergenic
1181005608 22:20012087-20012109 CACACTTCCCCAACTGGGTGGGG - Intronic
1181535002 22:23537236-23537258 CAGGCCACCCCTTCAGGGTAGGG + Intergenic
1181565506 22:23734651-23734673 CAGCCTCCCACTGCTGGGTGTGG + Intergenic
1181579154 22:23817442-23817464 CAGACTATGCCTTGAGGGTGAGG + Intronic
950488356 3:13286004-13286026 CAGATTCCCCCTTCAAGGTGAGG + Intergenic
950952522 3:17015640-17015662 CAGACTGGCCCATCTGGGAGGGG - Intronic
953648032 3:44773423-44773445 CATCCCTCCCCTTCTGGGTGGGG - Intronic
954128126 3:48544329-48544351 CAAACCACCCCTTCTGAGGGAGG + Intronic
954673018 3:52300523-52300545 CACTGTACCCCTGCTGGGTGGGG - Intergenic
958412323 3:93832998-93833020 CAGTCTGCCCCTACTGGGGGTGG - Intergenic
962176938 3:133165233-133165255 CAGACCACCCTTTCCTGGTGAGG + Intronic
966357997 3:179102710-179102732 CAGACTACAACTTCTCAGTGAGG + Intergenic
977568860 4:98609785-98609807 CAGACCTGCCTTTCTGGGTGTGG - Intronic
980898947 4:138886678-138886700 CAGTCTGCCCCTACTGGGGGGGG + Intergenic
984757271 4:183336613-183336635 CTGACCTCCCCTTCTGGGTTAGG - Intergenic
985659443 5:1149132-1149154 CACAGTCCCCCTTCTGGGTGCGG - Intergenic
986531467 5:8740803-8740825 CAGACTCTCCCTGCTGGGCGGGG + Intergenic
992653344 5:78883692-78883714 TAGTCTCACCCTTCTGGGTGAGG + Intronic
997800322 5:136854205-136854227 CATTCCTCCCCTTCTGGGTGGGG - Intergenic
999973089 5:156884371-156884393 CAGACTCCTGCTTCTGTGTGTGG - Intergenic
1005885327 6:30093119-30093141 CAGAGCACCTCTTCTGTGTGTGG + Intergenic
1012835000 6:104253474-104253496 CAGACTACCAAGTCTGTGTGAGG - Intergenic
1016341699 6:143068412-143068434 CAGGGTAGCCCTTCTGAGTGCGG + Intronic
1019510256 7:1414165-1414187 CAGGCTGCACCTGCTGGGTGGGG + Intergenic
1019916064 7:4133496-4133518 CACACAGCTCCTTCTGGGTGGGG + Intronic
1021841285 7:24723716-24723738 CTGTCTCCCTCTTCTGGGTGAGG + Intronic
1023929736 7:44697944-44697966 CAGAGTAGCCCATCTGGATGTGG + Intronic
1026234300 7:68512544-68512566 CAGACTTCCATTTCTGGGTATGG + Intergenic
1027382964 7:77631164-77631186 CAGACTACCACTACTGGATAAGG + Intronic
1029313213 7:99686753-99686775 CAGTCTGCCCCTACTGGGGGGGG - Intronic
1030064818 7:105651575-105651597 TAGAGGACTCCTTCTGGGTGAGG + Intronic
1041295816 8:56356598-56356620 CAGTCCACCCCTACTGGGGGGGG + Intergenic
1041342905 8:56865004-56865026 CAGACTTCCCAAACTGGGTGAGG + Intergenic
1047977502 8:130145593-130145615 AAGACTGCCCTTTCTGTGTGAGG - Intronic
1049174399 8:141182745-141182767 AAGACTCCCCCTTCTTGATGGGG - Intronic
1050261137 9:3842181-3842203 AAGACTTCCCCAGCTGGGTGCGG + Intronic
1057757348 9:97848752-97848774 CCGACTTCCCCTTCTCGTTGTGG + Intergenic
1057905920 9:98983382-98983404 CAGACTCCCCCATCTCAGTGAGG + Intronic
1062627213 9:137448710-137448732 CAGACTGCCCCTACCGGGTCCGG + Exonic
1185600261 X:1334377-1334399 CAAACTTCCTTTTCTGGGTGTGG + Intergenic
1188542069 X:31262028-31262050 CAGACTCCTCTTTCTGTGTGAGG - Intronic
1188765412 X:34085373-34085395 CAGAGAACCCCTCCTGGCTGTGG - Intergenic
1189302960 X:39966018-39966040 GAGCCAACCCCTTCTGGTTGGGG - Intergenic
1190247015 X:48697197-48697219 CAGACCCCCCCTTCAGAGTGCGG + Intronic
1190287878 X:48972462-48972484 GAGACTACCCCCTCGGAGTGGGG - Intergenic
1190536385 X:51432843-51432865 CAGTCTGCCCCTACTGGGGGTGG + Intergenic
1191949502 X:66572792-66572814 CAGGTTACCACTTCTAGGTGTGG + Intergenic
1193157508 X:78189585-78189607 CAGTCTGCCCCTACTGGGAGGGG - Intergenic
1198750495 X:139932780-139932802 CAGACTCCCTCTTCCGGGCGTGG + Intronic
1201936676 Y:19418241-19418263 TGGACTACCCCTGCTGTGTGAGG + Intergenic