ID: 1087153256

View in Genome Browser
Species Human (GRCh38)
Location 11:94877520-94877542
Sequence AGTAATGTGCAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087153248_1087153256 11 Left 1087153248 11:94877486-94877508 CCCCAGGAGACTGAAACTCAAAC No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data
1087153245_1087153256 23 Left 1087153245 11:94877474-94877496 CCCCACTTTAAACCCCAGGAGAC No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data
1087153249_1087153256 10 Left 1087153249 11:94877487-94877509 CCCAGGAGACTGAAACTCAAACA No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data
1087153250_1087153256 9 Left 1087153250 11:94877488-94877510 CCAGGAGACTGAAACTCAAACAA No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data
1087153247_1087153256 21 Left 1087153247 11:94877476-94877498 CCACTTTAAACCCCAGGAGACTG No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data
1087153246_1087153256 22 Left 1087153246 11:94877475-94877497 CCCACTTTAAACCCCAGGAGACT No data
Right 1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087153256 Original CRISPR AGTAATGTGCAAAAGATGGC AGG Intergenic
No off target data available for this crispr