ID: 1087157852

View in Genome Browser
Species Human (GRCh38)
Location 11:94922267-94922289
Sequence ACACAGGTATAGAATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087157852_1087157865 28 Left 1087157852 11:94922267-94922289 CCCCCAAGATTCTATACCTGTGT No data
Right 1087157865 11:94922318-94922340 CACGCATCTATTCCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087157852 Original CRISPR ACACAGGTATAGAATCTTGG GGG (reversed) Intergenic
No off target data available for this crispr