ID: 1087158585

View in Genome Browser
Species Human (GRCh38)
Location 11:94927638-94927660
Sequence CAAAGCAGCTGTTACTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087158585_1087158589 16 Left 1087158585 11:94927638-94927660 CCTTATGAGTAACAGCTGCTTTG No data
Right 1087158589 11:94927677-94927699 TTGAATATATGCAGAGAGCCTGG No data
1087158585_1087158590 28 Left 1087158585 11:94927638-94927660 CCTTATGAGTAACAGCTGCTTTG No data
Right 1087158590 11:94927689-94927711 AGAGAGCCTGGTACAGAACCTGG No data
1087158585_1087158588 -8 Left 1087158585 11:94927638-94927660 CCTTATGAGTAACAGCTGCTTTG No data
Right 1087158588 11:94927653-94927675 CTGCTTTGCTGGCTAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087158585 Original CRISPR CAAAGCAGCTGTTACTCATA AGG (reversed) Intergenic
No off target data available for this crispr