ID: 1087158952

View in Genome Browser
Species Human (GRCh38)
Location 11:94930529-94930551
Sequence AGGTGTGGCCATGGAGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087158948_1087158952 -5 Left 1087158948 11:94930511-94930533 CCAGGTATGGCAAGTTCTAGGTG No data
Right 1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG No data
1087158945_1087158952 12 Left 1087158945 11:94930494-94930516 CCTTTCATAGAAGAGTTCCAGGT No data
Right 1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087158952 Original CRISPR AGGTGTGGCCATGGAGTAAA GGG Intergenic
No off target data available for this crispr