ID: 1087159636

View in Genome Browser
Species Human (GRCh38)
Location 11:94936134-94936156
Sequence CAGAAAAAGCAGAGGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087159629_1087159636 9 Left 1087159629 11:94936102-94936124 CCTGACATGAATAGAAGGAGAGA No data
Right 1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG No data
1087159625_1087159636 30 Left 1087159625 11:94936081-94936103 CCAACCCAGGAGGAGGTGACACC No data
Right 1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG No data
1087159627_1087159636 25 Left 1087159627 11:94936086-94936108 CCAGGAGGAGGTGACACCTGACA No data
Right 1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG No data
1087159626_1087159636 26 Left 1087159626 11:94936085-94936107 CCCAGGAGGAGGTGACACCTGAC No data
Right 1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087159636 Original CRISPR CAGAAAAAGCAGAGGTAGAG GGG Intergenic
No off target data available for this crispr