ID: 1087161098

View in Genome Browser
Species Human (GRCh38)
Location 11:94948863-94948885
Sequence AGTGAGAGGCAAGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087161098_1087161102 2 Left 1087161098 11:94948863-94948885 CCTGCCTCATCTTGCCTCTCACT No data
Right 1087161102 11:94948888-94948910 AGTCTTGGTCAATGACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087161098 Original CRISPR AGTGAGAGGCAAGATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr