ID: 1087162605

View in Genome Browser
Species Human (GRCh38)
Location 11:94964082-94964104
Sequence GCTCAGAGCAGAACTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087162601_1087162605 16 Left 1087162601 11:94964043-94964065 CCACATATACATTAACCAAGGAG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 226
1087162600_1087162605 17 Left 1087162600 11:94964042-94964064 CCCACATATACATTAACCAAGGA 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 226
1087162602_1087162605 1 Left 1087162602 11:94964058-94964080 CCAAGGAGAAGTACCAGCTGAAG 0: 1
1: 0
2: 1
3: 20
4: 267
Right 1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG 0: 1
1: 0
2: 0
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087162605 Original CRISPR GCTCAGAGCAGAACTCTGGT TGG Intronic
901218292 1:7567031-7567053 GCTCAGAGCAGACAGCTGTTAGG + Intronic
901733545 1:11297617-11297639 GCTGAGATCAGAATCCTGGTGGG + Intergenic
903094773 1:20960493-20960515 GCTCATAGCAGAAATCTGGGAGG + Intronic
903594802 1:24485802-24485824 GCACAGGGCAGGACTCTGGGAGG + Intergenic
904875446 1:33651338-33651360 GCTCAGAACAGAGCTCTTCTGGG + Intronic
905206259 1:36344370-36344392 GCTCAGAGGACGACTCTGGGGGG - Intronic
907564580 1:55422873-55422895 GCTTAGAGCAGAGATCTGGAAGG + Intergenic
909666038 1:78134564-78134586 GATCAGAGCAGAAGTAGGGTGGG - Intronic
910259909 1:85284553-85284575 GCTGAGAGCTGAACACTGTTGGG + Intergenic
911735434 1:101331587-101331609 GCTCAGAGGAGAGGTCTGGGTGG + Intergenic
912746416 1:112249091-112249113 GTTCAAGGCAGAACTCTGGCTGG + Intergenic
914765766 1:150636384-150636406 TATCTGAGCAGAAATCTGGTTGG + Intergenic
914918162 1:151830887-151830909 CCTCAGAGCAGTCCTGTGGTGGG + Intronic
915298989 1:154941475-154941497 GCTCACAGCAGGGGTCTGGTAGG - Intergenic
915625101 1:157109583-157109605 GGTCAGAGCAGAACTGAAGTGGG + Intergenic
917049597 1:170905167-170905189 GCTCAGGGCAAAACTCTGCAAGG - Intergenic
918924519 1:190764572-190764594 GCTCAGAGCAGAATTTGGGAGGG - Intergenic
919193419 1:194252871-194252893 GCACAGAGTAGAACGGTGGTGGG + Intergenic
919513405 1:198493969-198493991 GCTGAGAGCTGGACTCTTGTTGG - Intergenic
920310691 1:205046587-205046609 GCTCAGAGCTTAAGCCTGGTGGG - Intronic
920885831 1:209927008-209927030 GCTGAGAGCATAGCTCAGGTGGG + Intergenic
921479962 1:215652827-215652849 GCCAAGAGCAGAACTTTGGTTGG + Intronic
1064143393 10:12808519-12808541 GCTCACAGCAGCACTTTGGGAGG + Intronic
1064164611 10:12975361-12975383 GGGCTGAGCAGAACTCTGGAAGG - Intronic
1064295939 10:14079251-14079273 GCTAAGAGCAGATCCCTGGCAGG - Intronic
1065407919 10:25389443-25389465 GCTGAGAGCTGAACACTCGTTGG + Intronic
1065451722 10:25865786-25865808 ACTCAAAGCAAAACTCTGATTGG + Intergenic
1065836210 10:29660586-29660608 CCACAGAGCAAAATTCTGGTGGG + Intronic
1073733612 10:106320512-106320534 GCTAAGAGCTAAACACTGGTTGG + Intergenic
1074781906 10:116808277-116808299 ACTGGGAGAAGAACTCTGGTGGG + Intergenic
1075007849 10:118843160-118843182 GCTAGGAGCTGAACACTGGTCGG + Intergenic
1075007867 10:118843334-118843356 GCTAGGAGCTGAACACTGGTTGG + Intergenic
1075007879 10:118843450-118843472 GCTAGGAGCTGAACACTGGTCGG + Intergenic
1075279366 10:121126604-121126626 GCACAGAGCCCAACTCTGGTTGG + Intergenic
1077012858 11:386585-386607 GCTGAGAGCTGAACACTCGTTGG + Intergenic
1077863915 11:6207571-6207593 GGAGAGAGCAGAACACTGGTGGG - Intronic
1079326248 11:19494969-19494991 CCTCAGAGGAGAATCCTGGTGGG + Intronic
1082918226 11:58463019-58463041 GCTCAGTGGAGCACCCTGGTTGG - Intergenic
1084494716 11:69497262-69497284 GCTCAGAGCAGGGCCCTGGAAGG - Intergenic
1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG + Intronic
1087311409 11:96548164-96548186 GCTCAGAGCAGAACTGAAGGAGG + Intergenic
1089816407 11:121180457-121180479 TCTCTCAGCAGAACTCTTGTAGG - Intronic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1092832947 12:12462911-12462933 GCTCATACCAGAACTTTGGGAGG - Intronic
1093031138 12:14289617-14289639 GCTCAGTGGAGAATCCTGGTTGG - Intergenic
1093764932 12:22952335-22952357 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1094607488 12:31961222-31961244 GCGCAGAGCACCACTCTGGGAGG + Intronic
1095042373 12:37456367-37456389 GCTCAGAGGAGACCCATGGTGGG - Intergenic
1099382167 12:81968428-81968450 GCTCAGAGCAGAAGTTTAATAGG + Intergenic
1099461574 12:82928300-82928322 AATCAGAGCAGAACTTTGGGAGG + Intronic
1099492354 12:83302881-83302903 GATCAGAGCAGAACTGTAGGAGG + Intergenic
1104016805 12:124967086-124967108 GCTCAGGGCAGAGTGCTGGTCGG + Intronic
1105474230 13:20717330-20717352 GCACAGGGCAGAACTCTGCTCGG + Intronic
1105631858 13:22177349-22177371 GCCCAGAGCAGAAATTTGGCAGG - Intergenic
1105986386 13:25571285-25571307 GCTCAGAGGAGATGTTTGGTGGG + Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1107871216 13:44748479-44748501 TCTCAGAGCAAATTTCTGGTAGG + Intergenic
1108588963 13:51895498-51895520 GCCCTGAAAAGAACTCTGGTGGG + Intergenic
1108839426 13:54593625-54593647 GCTCTGGGCAGAGCTCTGGTGGG - Intergenic
1109472755 13:62832246-62832268 GCTCAGAGCTCAACTGCGGTTGG + Intergenic
1111337198 13:86839800-86839822 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1113650544 13:112031364-112031386 GCCCAGAGAAGCCCTCTGGTGGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1118473079 14:66093424-66093446 GCTAAGAGCTGAACACTCGTTGG - Intergenic
1119306422 14:73611770-73611792 GGTCAGACCAGAACTCGGCTAGG + Intronic
1120597242 14:86456144-86456166 GTTCAGAGTAGAATTCTAGTTGG + Intergenic
1120871262 14:89339406-89339428 GCTCAGAGCAGATCTTAGTTAGG - Intronic
1120951399 14:90045239-90045261 GCTCAGAGCTGGAGTCAGGTGGG + Intergenic
1121963992 14:98287776-98287798 GCTCAAAGCTGAAGCCTGGTTGG + Intergenic
1123630899 15:22258887-22258909 GTACAGAGCAGAACTCGGGGCGG - Intergenic
1125718200 15:41831675-41831697 GCTGAGAGCTGAACACTCGTTGG + Intronic
1128393408 15:67198662-67198684 GCTCAGAGTCCAACTCAGGTGGG - Intergenic
1128732751 15:70032476-70032498 GCTCAGAGGAGAAATTTGGGAGG + Intergenic
1130899202 15:88194305-88194327 GCTCAGAGCAGAGCACTTGGGGG - Intronic
1134328444 16:13228504-13228526 GCTCAGAGCAGACCTCAGACTGG + Intronic
1135057041 16:19240377-19240399 GCTGAGAGCTGAACACTCGTTGG - Intronic
1137699144 16:50483748-50483770 GCTGAGAACAGAACTCTCCTAGG - Intergenic
1138033497 16:53579884-53579906 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1138561120 16:57801758-57801780 AGTTAGAGCAGAACTCTGGCTGG - Intronic
1139254635 16:65529154-65529176 GCTGAGGGCAGAACCCAGGTAGG - Intergenic
1140031752 16:71344743-71344765 GATCCGGGCAGAACTCTGATGGG + Intergenic
1143661949 17:8330682-8330704 TCCCAGGGCAGAACTCTGGAAGG + Intergenic
1144052287 17:11507381-11507403 GCTCTGAGCAGAAGGCAGGTAGG - Intronic
1145014399 17:19387206-19387228 GCCCAGCGCATAACTCTGGGCGG - Intronic
1146986851 17:37228269-37228291 AGTCAGAGCAGACCTCTGATTGG - Intronic
1149820681 17:59774201-59774223 ACTCAGAGCAGCAGTCTGCTTGG - Intronic
1150593530 17:66583994-66584016 GTTCACAGCAGAAGTCTGTTGGG + Intronic
1150847206 17:68671467-68671489 CCTCAGAGCAGGACTCTCTTAGG - Intergenic
1151142559 17:72008052-72008074 CCTCAGAGCAGACCTCTGCAGGG + Intergenic
1152539184 17:80966428-80966450 GGTCAGAGCAGAGCTCTGGGGGG + Intergenic
1153980468 18:10304529-10304551 GGTCAGAGCAGAACAGAGGTGGG - Intergenic
1154318482 18:13325403-13325425 GGACTGGGCAGAACTCTGGTTGG - Intronic
1155782221 18:29850705-29850727 GCTCAATAAAGAACTCTGGTAGG - Intergenic
1158821073 18:61159409-61159431 GCTCAGAGCAGAAATATTGGAGG - Intergenic
1159142210 18:64411103-64411125 GCTCAGAGAAGAATTCTGGGTGG - Intergenic
1159632584 18:70766066-70766088 GCTCAGAGCAGAACTGAAGGAGG - Intergenic
1160443837 18:78912535-78912557 GCTCAGAGCAGGACACAGCTTGG + Intergenic
1163288136 19:16362042-16362064 GGACAGAGCAGAATGCTGGTGGG + Intronic
1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG + Intergenic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1163948055 19:20558720-20558742 GTTCAGAGCAGAATTGTGTTAGG - Intronic
1165833835 19:38743087-38743109 GCTCAGCACAGAACTCCTGTGGG + Exonic
1167031889 19:46967835-46967857 GATCAGAGAAGGACTCTGGGAGG - Intronic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
927499841 2:23575315-23575337 GCCCAGAGCTGGGCTCTGGTGGG - Intronic
928804911 2:35139612-35139634 GCTCAGTTCAGAACTCTTGTTGG + Intergenic
928823485 2:35391525-35391547 GCTGAGAGCTGGACCCTGGTTGG - Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
929281598 2:40086754-40086776 GCACAGAGAAAAACTCTGTTTGG - Intergenic
929926817 2:46219450-46219472 GCACAGAGAGGAAGTCTGGTGGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
931845022 2:66194370-66194392 GCCCAGAGCAGAATTCTGTTGGG + Intergenic
932095138 2:68840382-68840404 GCACAGAGAAGAAAACTGGTAGG - Intergenic
932774511 2:74519606-74519628 GCTCAGAGCCAAAGGCTGGTAGG + Exonic
933555897 2:83830339-83830361 CATCAGAGAAGAACTCTGCTTGG + Intergenic
934777735 2:96949807-96949829 GCCCAGAGCAGAGCTCTGTGGGG + Intronic
941043657 2:160649353-160649375 GCTGAGAGCTGAACACTCGTCGG + Intergenic
942766278 2:179460928-179460950 ACTGAGAGCAGTACTGTGGTAGG - Intronic
943614025 2:190070807-190070829 ACTCAGAGGAGAAATCTGATGGG + Intronic
943965612 2:194328231-194328253 GCTGAGAGCTAGACTCTGGTTGG + Intergenic
943981614 2:194559695-194559717 GCTGAGTGCAGAACCATGGTGGG - Intergenic
945182512 2:207106491-207106513 GCTCATAGCAAAACCCTGGGAGG - Intronic
945431111 2:209766832-209766854 GAGCAGAGGAGAACTCTGGCTGG - Intergenic
946204235 2:218091953-218091975 GCTCTGACCAGAGCTCTGGACGG + Intergenic
947852972 2:233303472-233303494 GCTCAGGGCAGCCCTCTGATGGG + Intergenic
948367988 2:237471070-237471092 GCTCAGTGCAGAGCCCTGATAGG - Intergenic
948975117 2:241459203-241459225 GCACAGAGGGGTACTCTGGTGGG - Intronic
1169252933 20:4074073-4074095 GCTCACACCAGTACTCTGGGAGG - Intronic
1169274765 20:4226214-4226236 GCTCACAGCAGACTTCAGGTTGG - Intronic
1169894469 20:10488086-10488108 ACTATGAGCAGAACTCTGTTGGG - Intronic
1170014405 20:11764847-11764869 GCCAGGAGGAGAACTCTGGTTGG - Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1174147212 20:48460220-48460242 GCACAGGGCAGAACCCTGGCTGG + Intergenic
1174328604 20:49799556-49799578 GCACAGAGAAGAAGTCTGGAGGG - Intergenic
1174615455 20:51832107-51832129 GCTGAGAGCAGATCTTTGGAAGG + Intergenic
1175605722 20:60310828-60310850 TCTCAGAGCAGCTCTCTGGCAGG + Intergenic
1175727770 20:61331502-61331524 GATCAGAGGACAGCTCTGGTGGG - Intronic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1179887111 21:44318925-44318947 GATCAGAGCAGAGCCCTGGGAGG + Intronic
1180140118 21:45888146-45888168 GCTCAGAGCAGGGCTCAGCTAGG - Intronic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1183068565 22:35380668-35380690 GCTCAGAGCAATAGCCTGGTGGG - Intronic
1183581372 22:38728496-38728518 TCTCAGAGCAGAGGTCTGGTTGG + Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
949478717 3:4472894-4472916 GCCCACAGCAGAGCTCTTGTAGG - Intergenic
950398399 3:12751607-12751629 TCTCAGAGCAGAATTCAGCTAGG + Intronic
951799213 3:26576389-26576411 CCTCAGATCACAACTCTGATTGG + Intergenic
953720010 3:45347034-45347056 GCTCATTACAGAACTCAGGTAGG - Intergenic
954257306 3:49415768-49415790 GCTCACGGGAGAAGTCTGGTTGG - Exonic
954654059 3:52183144-52183166 GCTCATAGCAGCTATCTGGTGGG - Intergenic
955299547 3:57764163-57764185 GCTCTGCTCAGAACTCTCGTAGG - Intronic
955536960 3:59933951-59933973 GTTCAGAGTAGAGCTCTGGGAGG + Intronic
960346335 3:116538296-116538318 ACTCCAAGCAGAACTCTAGTGGG + Intronic
961824309 3:129590872-129590894 GCTCAGAGCAGGACTCAGGGAGG + Intronic
962239266 3:133737462-133737484 GATCAGAGCAGAGCTGTGGGAGG + Intergenic
964176944 3:153835419-153835441 GCTAAGGGCAGACCTCTTGTTGG - Intergenic
966107853 3:176359318-176359340 AATCAGAGCAGGACTCTGATTGG - Intergenic
968770184 4:2500456-2500478 ACTCAGAGCAGAATTCTGGAAGG + Intronic
970540542 4:17074038-17074060 GCTCAGAGCAGAATGTTGATGGG - Intergenic
972802110 4:42487468-42487490 ACTCAGAACAGAAATCTGATAGG - Intronic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
973680741 4:53316309-53316331 GAACAGTGCAGATCTCTGGTGGG + Intronic
974619901 4:64341104-64341126 GCTAAGAGCTGAACACTTGTTGG + Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
976815803 4:89147977-89147999 GCTCAGAGGAGACCTGCGGTGGG + Intergenic
977487288 4:97665412-97665434 GCTGAGAGCTGAACACTTGTTGG - Intronic
977571403 4:98633041-98633063 GCTCAGACCAGGGCACTGGTTGG + Intronic
977597933 4:98904092-98904114 TTTCAGAGCGTAACTCTGGTTGG + Intronic
977816200 4:101416605-101416627 GCTCAGAGGAGACCCATGGTAGG + Intronic
979517155 4:121622941-121622963 GCTAAGATCAGAACACTGTTAGG + Intergenic
980481291 4:133390611-133390633 GCTGAGTGCAGAGCTGTGGTGGG + Intergenic
983961673 4:173762132-173762154 GCCAAGAGCAGAACTCTGGGAGG + Intergenic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
984948466 4:184988639-184988661 GCTCGGAGCAAACCTCTGGGTGG - Intergenic
985812214 5:2098466-2098488 GCGGAGAGCAGAACTCAGGGAGG - Intergenic
986575452 5:9208342-9208364 GCCTAGAGCAGTACTCTGGCCGG - Intronic
987135562 5:14896728-14896750 GTTCAGAGCAGAAGTCTAATAGG + Intergenic
990117857 5:52411325-52411347 GGGCAGAGGAGGACTCTGGTTGG - Intergenic
990595346 5:57307574-57307596 GCTCAGAGCTGACTTCTGATGGG - Intergenic
991057363 5:62334836-62334858 GCTCAGCGCAGCCCTCAGGTGGG + Intronic
991502561 5:67291488-67291510 GCTGAGAGCAGAAATCTGCTTGG - Intergenic
995054012 5:107739175-107739197 TCCCTGAGCAGAGCTCTGGTGGG - Intergenic
995427299 5:112039853-112039875 TGGCAGAGCAGAACTCTGGGGGG - Intergenic
997245006 5:132340253-132340275 CTTAAGAGGAGAACTCTGGTAGG + Intronic
999318677 5:150600313-150600335 GCCCAGAGCAGCACTCCAGTGGG + Intergenic
999734981 5:154506281-154506303 GCTCCAAGCAGGACTCTGGGAGG - Intergenic
1001769066 5:174278974-174278996 GCACAGTGCCCAACTCTGGTAGG + Intergenic
1002517969 5:179773615-179773637 CCACAGAGCAGAAATTTGGTGGG + Intronic
1003198172 6:3933167-3933189 GCTCAGGCCAGAACTCAGGGAGG + Intergenic
1004520269 6:16355199-16355221 GCTGAGAGCAGAACCCAGCTTGG + Intronic
1004930116 6:20454842-20454864 GCTCTGAGCTGAACCCTGGCTGG - Intronic
1006093612 6:31642533-31642555 GCTTAAAGCAGAAGTATGGTAGG + Intronic
1006410095 6:33868426-33868448 GCTCAGGGCAGAAGTCAGATTGG - Intergenic
1007224043 6:40300448-40300470 GCTCACAGCAGAACCCAGCTTGG - Intergenic
1007432248 6:41783475-41783497 TGTCAGTGCAGAACTCTGGCTGG + Exonic
1011279157 6:85659814-85659836 GGTAAGAGCCTAACTCTGGTGGG + Intergenic
1011935342 6:92770036-92770058 GCTCAGACCACCACTCTGGAGGG + Intergenic
1014480280 6:121927791-121927813 GCTAAGAGCATCACACTGGTGGG + Intergenic
1014634564 6:123829276-123829298 GCTCAAGGGAGAACTCTGGGTGG - Intronic
1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG + Intronic
1019215986 6:170444175-170444197 GCTCAGAGCAGAAGGCTTGTAGG + Intergenic
1019290219 7:246647-246669 GCTCAGGGCAGCACTCGGGGTGG - Intronic
1019290238 7:246732-246754 GCTCAGGGCAGCACTCGGGGTGG - Intronic
1021425762 7:20497079-20497101 GTTCAGGTCAGAACTCTTGTTGG - Intergenic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023512290 7:40966507-40966529 GCTCAGAGCCTAACTCTGTGAGG + Intergenic
1025301927 7:57825032-57825054 GTTCAGAGCAGAGCTCAGGCAGG - Intergenic
1029109770 7:98207057-98207079 TGTCAGAGCAGAACTCAGGGAGG - Exonic
1029370852 7:100149491-100149513 GGTCAGCGCAGAAGTCTAGTGGG - Exonic
1030148625 7:106380832-106380854 GCTCACAGGACAACTCTGGGAGG + Intergenic
1035279983 7:157772470-157772492 GCACTGAGCAGGACTCTGCTGGG - Intronic
1035670351 8:1412233-1412255 GCTCAGAGCAGGAGGCTGGCGGG - Intergenic
1036182648 8:6598402-6598424 GCTCAGAGCTGCACTCTGGCCGG - Intronic
1037432095 8:18824383-18824405 GCTGAGACCTGAACTTTGGTCGG - Intronic
1038331811 8:26615026-26615048 GCTCTTGGCAGAACTCTGGATGG - Intronic
1039949149 8:42153838-42153860 GCTCAGAGAATAGCTCTGATTGG + Intronic
1040009901 8:42652829-42652851 GATCAGAGCAGAACTTTGGAAGG - Intergenic
1041205464 8:55494606-55494628 GCTGAGAGCTGAACACTCGTTGG - Intronic
1041378290 8:57224390-57224412 GCTCAGAGCAGAAGTTTAATAGG + Intergenic
1041488971 8:58410900-58410922 GCTAAAAGCAGAACTCTGCCGGG - Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042625133 8:70748963-70748985 GCACAGAGGAGACCTATGGTGGG - Intronic
1046587689 8:116167852-116167874 GCTCAGAGGAGATTTCTGATAGG + Intergenic
1049394719 8:142394622-142394644 GCACAGAGCAGAGCTGTGGGAGG - Intronic
1050152488 9:2630564-2630586 GCTCCGAGCAGCACCCTGGCAGG - Intronic
1050239603 9:3621328-3621350 GATCAGAGCAGAACTGAAGTAGG - Intergenic
1050681586 9:8117735-8117757 CCTCAATGCAGAACTCTGGAAGG - Intergenic
1051174071 9:14346424-14346446 GCGCAGAGCACAACCCTGGCAGG + Intronic
1056249215 9:84731136-84731158 GCTTAGAGCAGATTTCTGCTCGG + Intronic
1057066605 9:92058691-92058713 GCTCAGAGCAGGATACAGGTGGG + Intronic
1057189716 9:93079892-93079914 GCTCAGTGCAGAGCCCTGCTGGG - Intronic
1059171139 9:112126280-112126302 GCTCAGTGGAGAAGTCTGGGAGG + Intronic
1059441201 9:114307847-114307869 GCTCAGAACAGAACCTGGGTTGG - Intronic
1060199345 9:121643373-121643395 GGTAAGGGCAGAACTCTGGTGGG - Intronic
1060374778 9:123108262-123108284 GCACAGATCAGAACTCAGGAAGG - Intergenic
1060375081 9:123110181-123110203 GCTCCAAGCAGAACTCTGTCTGG - Intronic
1060810359 9:126608601-126608623 GCTCAGAGCTGGACCCTGGCGGG - Intergenic
1061574303 9:131496601-131496623 GCTCAGAGCAGCAGGCAGGTTGG + Exonic
1062386537 9:136313942-136313964 GCTCAGGGGAGAGCTCTGGCAGG + Intergenic
1186067359 X:5780347-5780369 TCTCAGATTAGAACTCTGATAGG + Intergenic
1188238262 X:27754694-27754716 GCTCAGGCCACAACTCTGGATGG - Intergenic
1190259559 X:48789582-48789604 CCTGAAAGCAGAACTCTGGTGGG + Intronic
1193217247 X:78878018-78878040 GCTCAGAGCAGAACTGAAGGAGG + Intergenic
1194420588 X:93668727-93668749 GCTCAGAGCCCAACTCAGGAGGG + Intergenic
1196931503 X:120686062-120686084 ATTCAGAGGAGAACTCTGGCTGG - Intergenic
1201050039 Y:9923610-9923632 GCTCACAGCAGCAACCTGGTTGG - Intergenic