ID: 1087164456

View in Genome Browser
Species Human (GRCh38)
Location 11:94987166-94987188
Sequence CTGTGAATGCAAATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087164454_1087164456 1 Left 1087164454 11:94987142-94987164 CCTGGAGTTGGGGGTGGAAATGA 0: 1
1: 0
2: 7
3: 166
4: 4194
Right 1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG 0: 1
1: 0
2: 0
3: 26
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087164456 Original CRISPR CTGTGAATGCAAATGGAACA AGG Intronic
902262484 1:15237248-15237270 CTGTGAAAGCCAAAGAAACATGG + Intergenic
905298784 1:36972022-36972044 CTCTGAATGGAAATGAATCACGG + Intronic
907966901 1:59340470-59340492 CTTTGAAAGGAAATGGAACATGG + Intronic
908556723 1:65263957-65263979 CTGTGAAGAAAAATGAAACATGG - Intronic
909753095 1:79189291-79189313 CTGTGAATGCAGTTGGCATAAGG - Intergenic
912460784 1:109829584-109829606 CTGTGATTGCACAGGGACCATGG + Intergenic
912663669 1:111559686-111559708 CAGTGATAGCAAAAGGAACATGG - Intronic
913598995 1:120404975-120404997 CTGTGACTGCAACTGGATCAAGG + Intergenic
914088383 1:144474645-144474667 CTGTGACTGCAACTGGATCAAGG - Intergenic
914310228 1:146459565-146459587 CTGTGACTGCAACTGGATCAAGG + Intergenic
914379607 1:147104620-147104642 CTGTGACTGCAACTGGATCAAGG - Intergenic
914591881 1:149113574-149113596 CTGTGACTGCAACTGGATCAAGG - Intergenic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
918551867 1:185752001-185752023 CTGTCAATGCATCTTGAACAGGG + Intronic
918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG + Intergenic
919953112 1:202384566-202384588 AAGTGATTGCTAATGGAACAGGG + Intronic
920603227 1:207350464-207350486 CTGTGAATCCATCTGGTACAGGG + Intronic
920691782 1:208152805-208152827 CTGGGGATGCAATTGGAAAATGG - Intronic
924823795 1:247519107-247519129 ATGTGAATGTGAATGGAGCAAGG + Intronic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1064243511 10:13651405-13651427 CTTTGAATGTAGATAGAACATGG + Intronic
1064709646 10:18110424-18110446 GAGTGAATGTAAATGGAAAAGGG + Intergenic
1065154274 10:22853486-22853508 TAGTGGATGCAAGTGGAACAAGG + Intergenic
1068208046 10:53882932-53882954 CATTAAATGCAAATGGACCAAGG + Intronic
1068800941 10:61139098-61139120 CTGTGAAAGTTAAAGGAACATGG - Intergenic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1072712950 10:97729713-97729735 CTGTCAATGAAAATGTAAAATGG - Intergenic
1073117635 10:101100633-101100655 CTGGGAATGGAAGTGAAACAGGG - Intronic
1073322939 10:102626584-102626606 CTGTGAATGGGAATGGAAGTTGG + Intronic
1073941045 10:108698633-108698655 ACGTGACTGCAAATGGTACAGGG + Intergenic
1073999260 10:109352301-109352323 CTGTGAATTCATCTGAAACACGG + Intergenic
1074127244 10:110538693-110538715 CTGGGAAGGCAAAGGGAACTGGG + Intergenic
1076281874 10:129253165-129253187 ATGTGAAAGAAAATGGAATATGG + Intergenic
1077164779 11:1130123-1130145 TTGTGAATGAACAAGGAACAAGG - Intergenic
1077251261 11:1561723-1561745 CTGTCCCTGCAAATGGACCAAGG + Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078666332 11:13328635-13328657 CTGTAGATGGAAATGGAACTTGG + Intronic
1078738938 11:14048543-14048565 CTTTGCATCCAAATGGAAAATGG - Intronic
1079012914 11:16844428-16844450 CTGTGAAGGCAAAAAGTACAGGG + Intronic
1079708373 11:23650743-23650765 GTGTGAATGTAAAAGGAAAACGG - Intergenic
1080794151 11:35547793-35547815 CTGTCCATGCTAATGGAACGAGG + Intergenic
1081011958 11:37824467-37824489 CTGTAAGGGGAAATGGAACACGG + Intergenic
1081378766 11:42389502-42389524 CTGTAGGTGCAAATGGAAGAAGG + Intergenic
1084736353 11:71108148-71108170 CTGTGAAGGTAAATGGACCCAGG - Intronic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085925773 11:81018835-81018857 CTGTGGAAGCAAATGGAATGGGG - Intergenic
1086538558 11:87880278-87880300 GTGAGACTGCAAATGGAATATGG + Intergenic
1086761729 11:90639614-90639636 CTTTTGATGCAAATGGAAAAGGG - Intergenic
1086996487 11:93362592-93362614 TTGTGAATGGGAATGGAAAATGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087289106 11:96300205-96300227 ATGTGAATGCTAATGAAACTGGG + Intronic
1087764670 11:102137610-102137632 CTGTGATTTCACATGGAGCAGGG - Intronic
1087794976 11:102446255-102446277 CTCTGACTGCAAATGAAATAAGG + Intronic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1088997168 11:115011123-115011145 CTGTGAATGCTACCAGAACAGGG + Intergenic
1089938261 11:122388135-122388157 GTTTGAAGGCAAATGGAATATGG + Intergenic
1091398897 12:171089-171111 CTTTGAATGCAAAGAGCACAGGG - Intronic
1091481343 12:834966-834988 ATGTGTATGCAAGTGGAAAAGGG + Intronic
1092632696 12:10400153-10400175 CTGTTAATGAAAATGTAAAATGG + Intronic
1093274667 12:17109449-17109471 CACTCAATGCAAATGGAACACGG + Intergenic
1093289791 12:17305471-17305493 CTGTGAATCCACCTGGTACAGGG + Intergenic
1098570215 12:71980025-71980047 CTGTGAAGACAAATAGAGCATGG + Intronic
1099356357 12:81640610-81640632 CTGTCAATGGAAATGGATGATGG - Intronic
1100040814 12:90314691-90314713 CTGTGGATGCATATGAAAAATGG + Intergenic
1101559585 12:105843744-105843766 CTGTCCTTGCAAATGGAAAAAGG - Intergenic
1101995070 12:109519486-109519508 ATGTGAAAGCAAGTGGCACATGG - Intronic
1102791442 12:115649726-115649748 GTCTTAATGCAAATGGAAGATGG - Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1108037879 13:46311035-46311057 CTGTGAATCCAACTGGTCCAGGG - Intergenic
1108417676 13:50215984-50216006 CTCAAAATGCACATGGAACATGG + Intronic
1109533769 13:63688465-63688487 CTGTAAAGGCAAATGAAAAATGG - Intergenic
1109984531 13:69961308-69961330 CTGTATATGCAAATTGGACAAGG + Exonic
1110497159 13:76181548-76181570 CTGTCAATGCAACTGGTCCAGGG + Intergenic
1110915240 13:81012770-81012792 CTGTGAATCCATCTGGTACAGGG + Intergenic
1111787581 13:92809574-92809596 ATGTGAATGTACGTGGAACATGG - Intronic
1113833251 13:113313446-113313468 ATGTGATTCCAAATGGAAAAAGG + Intronic
1114629250 14:24148556-24148578 CTGTGAATGTTAAGGGACCAGGG + Intronic
1115385800 14:32795164-32795186 CTGTGAATCCAAATGGTCCTGGG - Intronic
1116089949 14:40292356-40292378 CTGTGAATCCATCTGGACCAGGG + Intergenic
1116780119 14:49227794-49227816 CTGTTCATGAAACTGGAACATGG - Intergenic
1118855436 14:69618108-69618130 CTGTGGTTCCAATTGGAACAAGG - Intronic
1119613502 14:76083204-76083226 CTGTGAATGCAAACAAAAAAAGG - Intronic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1124705105 15:31957149-31957171 CTCTGAATGCAAAAGGAAACGGG + Intergenic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128053858 15:64685370-64685392 CTGAGGATGCATATGGAGCAGGG - Exonic
1128332998 15:66768450-66768472 CTATGAAAGTAAATGGAACAGGG - Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1130193338 15:81756876-81756898 CTGTGAAAGAAAATGGGACCGGG + Intergenic
1131858403 15:96624866-96624888 CAGGGCATGCAAAAGGAACATGG + Intergenic
1132487947 16:206190-206212 AAGTGAATGCAAAGGCAACAAGG + Intronic
1133256115 16:4517412-4517434 CAGTGAATTCCAATGGCACAGGG + Intronic
1133407469 16:5536693-5536715 CAGAGAAGGGAAATGGAACAAGG + Intergenic
1134166178 16:11931555-11931577 CTGAGAATGCAATGGGAGCAGGG + Intronic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1135311568 16:21408980-21409002 CTGAGAATGCAATGGGAGCAGGG + Intronic
1135364520 16:21841432-21841454 CTGAGAATGCAATGGGAGCAGGG + Intronic
1135447323 16:22529917-22529939 CTGAGAATGCAATGGGAGCAGGG - Intronic
1136150731 16:28346889-28346911 CTGAGAATGCAATGGGAGCAGGG + Intronic
1136166968 16:28460727-28460749 CTGAGAATGCAATGGGAGCAGGG + Intronic
1136196008 16:28654305-28654327 CTGAGAATGCAATGGGAGCAGGG - Intronic
1136212346 16:28768428-28768450 CTGAGAATGCAATGGGAGCAGGG - Intronic
1136257067 16:29048340-29048362 CTGAGAATGCAATGGGAGCAGGG - Intronic
1136308273 16:29387976-29387998 CTGAGAATGCAATGGGAGCAGGG + Intronic
1136321690 16:29489514-29489536 CTGAGAATGCAATGGGAGCAGGG + Intronic
1136436370 16:30229484-30229506 CTGAGAATGCAATGGGAGCAGGG + Intronic
1136709195 16:32220488-32220510 TTGTGAATGGAAATGTAGCAGGG - Intergenic
1136758715 16:32708931-32708953 TTGTGAATGGAAATGTAGCAGGG + Intergenic
1136809393 16:33161448-33161470 TTGTGAATGGAAATGTAGCAGGG - Intergenic
1136815869 16:33271528-33271550 TTGTGAATGGAAATGTAGCAGGG - Intronic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1139855970 16:69980404-69980426 CTGAGAATGCAATGGGAGCAGGG + Intergenic
1139902581 16:70339942-70339964 CTGAGAAGGCAAATATAACAGGG - Intronic
1140366758 16:74387675-74387697 CTGAGAATGCAATGGGAGCAGGG - Intronic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1141790074 16:86228309-86228331 CTCTGAATGCCAAGGAAACAGGG - Intergenic
1203060869 16_KI270728v1_random:969262-969284 TTGTGAATGGAAATGTAGCAGGG + Intergenic
1143598775 17:7930814-7930836 GTGTGAATGCACAAGGAATAAGG + Intronic
1144607201 17:16677401-16677423 CTGTGAGTGCAGATGGCTCAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148727066 17:49800789-49800811 CTGTGAAGGAAAATGAAACTGGG + Intronic
1148748181 17:49930021-49930043 ATATGAATGCAAATGAACCAAGG - Intergenic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154117440 18:11623612-11623634 CTGAGAATGCAATGGGAGCAGGG + Intergenic
1156356485 18:36346457-36346479 ATGTTAATGCAAATGGTAAATGG + Intronic
1157421635 18:47552349-47552371 CTGTGTATGCTAATTGTACAAGG - Intergenic
1157493384 18:48139030-48139052 CTGTGGGTGCATAAGGAACAGGG + Intronic
1157704989 18:49798684-49798706 TTTTGAATGCAGATGGAACTGGG + Intronic
1158080738 18:53587502-53587524 CTGGGTATGAAAATGAAACAAGG - Intergenic
1158251593 18:55494482-55494504 CTTTAAATGCAAATGCATCAGGG - Intronic
1158803801 18:60945593-60945615 CTGTGGTTGCAGATGAAACATGG + Intergenic
1159133339 18:64306729-64306751 GTGTGAATGCAAATAGGAAAAGG + Intergenic
1159440244 18:68469425-68469447 CTATGGAAGCAAAGGGAACAGGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159886728 18:73914674-73914696 CTGTGAATACAAATATTACAAGG + Intergenic
1160362133 18:78292690-78292712 CTGTGCATGGGATTGGAACAAGG - Intergenic
1161881549 19:6957924-6957946 CTGTAAGTGCAAATGGAAGGAGG - Intergenic
1164782173 19:30901592-30901614 CTGTGAATGCCAATGCAATCAGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165850169 19:38845520-38845542 CTGTGAAGGCATCTGGCACATGG + Intronic
1166613150 19:44218110-44218132 ATGTGTATGAAAAAGGAACATGG - Intronic
925672063 2:6321182-6321204 CTGTGAATGCATATGGTCCAGGG - Intergenic
926079716 2:9975061-9975083 TTGTGAATGTAAGTGGAAAAGGG + Intronic
926329224 2:11811002-11811024 CTGAGAATGCTAGAGGAACAGGG + Intronic
926627107 2:15101095-15101117 GTGTCGATCCAAATGGAACAGGG - Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927123654 2:19992686-19992708 CTGAGAGTGCAAATTGTACAAGG - Exonic
929639626 2:43564597-43564619 CTGTGAATGCAAACCTTACATGG - Intronic
930178413 2:48324833-48324855 ATGTAAATGCAGTTGGAACACGG + Intronic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
931542683 2:63346794-63346816 GAGGGAATGCAAGTGGAACATGG - Intronic
932088394 2:68782843-68782865 CCTTGAATGCATTTGGAACAAGG + Intronic
932834611 2:75024402-75024424 CTGTGAAAGAAAATAAAACAGGG - Intergenic
933283112 2:80354561-80354583 TTGTGAAAGCAAATGGGATAAGG + Intronic
935331964 2:101983669-101983691 CTGTGAATGAAAATCAAATAAGG - Intergenic
936920151 2:117680177-117680199 GTGTGTATGCAAATAGAAGAGGG - Intergenic
937967556 2:127525726-127525748 CTATGCATGCAACTGAAACATGG + Intronic
938861578 2:135375088-135375110 CTGCTAATGGAAATGGAAAATGG + Intronic
939186890 2:138871735-138871757 CTGTTTATCAAAATGGAACAAGG + Intergenic
940324892 2:152414816-152414838 ATGTGAATGCACATGAAAGAGGG - Intronic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941514906 2:166461499-166461521 CTGTTATTGTAACTGGAACATGG + Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
947134549 2:226964177-226964199 ATATGAATGTAAATGGAACGGGG - Intronic
948081082 2:235205930-235205952 CTGTGAATCAATCTGGAACAAGG + Intergenic
948188474 2:236040452-236040474 CTGTGAATACGCATGGACCATGG - Intronic
1169056280 20:2624214-2624236 CTGTGAATGCCACAGGCACATGG + Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1172657908 20:36548217-36548239 CTCTGCATGCAAGTGGAACAGGG + Intronic
1172812436 20:37658452-37658474 CTATGATTGCTAATGGAGCAGGG - Intergenic
1174680791 20:52406176-52406198 TTGTGAGTGGAAATGGAAAATGG - Intergenic
1175139852 20:56852856-56852878 CTGTCACTGCAAACCGAACAAGG - Intergenic
1175628746 20:60513187-60513209 CATTGACTGCAAAGGGAACAGGG - Intergenic
1176036985 20:63044300-63044322 CTGGGAATGCCAGGGGAACACGG + Intergenic
1178230489 21:30778329-30778351 ATGTGAATGCTAATAGAACTAGG - Intergenic
1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG + Intronic
1179713633 21:43276624-43276646 CTGTGAATGAAAGTTGACCAAGG - Intergenic
1181494639 22:23281150-23281172 CTGTGTATGAAAAGGGCACAGGG - Intronic
1182017560 22:27053334-27053356 CTATGAAGGCAAATGAATCAGGG - Intergenic
1182189683 22:28445817-28445839 CTATGAAGGAAAATGTAACAGGG - Intronic
950918583 3:16669819-16669841 CTGTGAGTGGAAATGGCACATGG - Intronic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951617195 3:24560431-24560453 CTGTGAGGGGAAATGGAAAAAGG + Intergenic
952170519 3:30801681-30801703 CAGTAAATGCAAATGGAATTTGG - Intronic
952370062 3:32713631-32713653 GAGTGACTGCAAATGGTACAGGG - Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955818303 3:62871036-62871058 CTGTGAATTGAAATATAACATGG - Intronic
957399914 3:79697148-79697170 TTGGGAAGGCAGATGGAACAGGG + Intronic
959195582 3:103176380-103176402 CTGTTAATGGAAATGCAAAATGG - Intergenic
959514719 3:107252054-107252076 CTGTGAATCCAAATAGCAGATGG + Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961145988 3:124593689-124593711 CTGTGAAAGCAAATAGCAAATGG - Intronic
962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG + Intronic
962267693 3:133955310-133955332 CTGTGCTAGCAAATGGGACATGG + Intronic
962682000 3:137810008-137810030 CTGTGAAGACAAATGGATCTTGG - Intergenic
964919440 3:161878453-161878475 CTGTGAATCCATCTGGACCAGGG - Intergenic
965147426 3:164924562-164924584 CTGTGAATCCACTTGGACCAGGG + Intergenic
965550189 3:169956567-169956589 CTGTGAAAGCATATAAAACATGG - Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
966825348 3:183960412-183960434 CTGTGACTGCGATTGGGACAAGG - Intronic
970254136 4:14149625-14149647 CTTTGAATGCAAAAGAAAGAAGG + Intergenic
971958055 4:33448584-33448606 CTCTGATTGCAAATGGACTAAGG - Intergenic
973107027 4:46352684-46352706 CAGTGAATGGAAATGGACAATGG - Intronic
973734464 4:53856796-53856818 CTATGGATGAACATGGAACATGG + Intronic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
974466849 4:62268862-62268884 CTGTGAATACAAAAGGAAACAGG + Intergenic
975008621 4:69321668-69321690 CTGTGAGGGCAAATGGTCCATGG + Intronic
975018939 4:69463240-69463262 CTGAAAATGCAAAGGAAACACGG + Intergenic
976217003 4:82724877-82724899 CTCTGAGAGCAAATGGAACATGG + Intronic
976539523 4:86257372-86257394 CTGTGAGTGGATATGGTACATGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977795260 4:101156979-101157001 CTGTGATTGCTAAGGGAACGTGG - Intronic
978015058 4:103734018-103734040 CTGTTGATGCAACTGGAAAATGG - Intergenic
982759788 4:159267649-159267671 GTGTGATTGCAGATGAAACAAGG + Intronic
984013508 4:174400214-174400236 ATGTCAATGCAACTGGAAGATGG + Intergenic
986823135 5:11491205-11491227 CTGGGAAAGCAACTGGAACCAGG - Intronic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
990078218 5:51877991-51878013 GTGTGTATGAAAATGAAACAAGG - Intergenic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
992013675 5:72555735-72555757 CTGAGAAAGCTAATGGAAGATGG - Intergenic
992363327 5:76065269-76065291 CTGTGACTGAAAATAGAAAATGG + Intergenic
992366172 5:76092467-76092489 TTTTGAATGAAAAAGGAACATGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
998923622 5:147098515-147098537 TTGGGAATGGAAATGGAAAAGGG - Intergenic
1000345011 5:160307239-160307261 CTGGGAATGCCAAGGTAACAAGG + Intronic
1000719542 5:164690058-164690080 CTGTTAATGGAAATGTAAGATGG + Intergenic
1002986782 6:2197557-2197579 TTGTGAAGGCAAATGGTGCAGGG - Intronic
1005842805 6:29755267-29755289 CTTTGAGTATAAATGGAACAGGG - Intergenic
1008050833 6:46899063-46899085 TTGTGAATGGAAATGTATCAAGG + Intronic
1008289579 6:49697478-49697500 GTGAGATTGCAAATGGAAGATGG - Intronic
1008401670 6:51070279-51070301 CTGTGAATGACAATGGAGAAGGG - Intergenic
1008679167 6:53853997-53854019 ATGTGAATGCTAATGGAACTAGG - Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1010771104 6:79832077-79832099 CTTTGAATGGGAATGGAAAAAGG - Intergenic
1011571199 6:88737665-88737687 CTGTGTATTCACATGGCACAAGG - Intronic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1014352054 6:120357856-120357878 CTCAGAGTGCAAATGGAACCAGG + Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015542764 6:134332572-134332594 CCCTGAATGCATATGTAACATGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016071467 6:139744124-139744146 CTGTGCATGGATATGGAAAAGGG + Intergenic
1016494642 6:144646687-144646709 CTGGGAAAGCAAATGTATCAGGG + Intronic
1016743124 6:147549491-147549513 CTGTGCATGAAAAAAGAACAAGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1017368361 6:153672410-153672432 CTGTGTATGGACATGGTACATGG - Intergenic
1019287151 7:229344-229366 CTGGGAATGAGAATGGCACAGGG - Exonic
1019636648 7:2079548-2079570 CTGGGAATGCAAATTGAATTTGG - Intronic
1021267949 7:18547924-18547946 TTGTGAATGCAAATGGAGGGAGG - Intronic
1022278427 7:28880412-28880434 GTGAGATTGCAAATGAAACAAGG - Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022634981 7:32123242-32123264 CTGTGAATGCATGTGGTACTAGG - Intronic
1023048288 7:36230180-36230202 CTGTGCAGGCAAATGGCACTGGG - Intronic
1023856565 7:44187783-44187805 CTGTGAATGCAAGGGGCTCAGGG + Intronic
1025147474 7:56517237-56517259 CCTTGAATGCAAATGGCACTTGG - Intergenic
1029862908 7:103593968-103593990 CTAGAAATGCAAATGGTACATGG - Intronic
1030242687 7:107346362-107346384 CTGTGACTGGAAAGGAAACAAGG + Intronic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1031954018 7:127923606-127923628 CTGTGAATTAAAATGGCACTTGG + Intronic
1033193638 7:139307738-139307760 CTGAGAATGCAAAGGCAAGATGG - Exonic
1034077493 7:148246393-148246415 CTGTGATTGCAAAAGCAACCGGG + Intronic
1034692885 7:153028132-153028154 CTGTGATTGGAACTGGAAGAGGG + Intergenic
1035742777 8:1941075-1941097 CTGTGAATAAAAATGGCAGAAGG - Intronic
1038659189 8:29482071-29482093 CAGTGAGTGCAAATGGAAGGTGG + Intergenic
1040824082 8:51598848-51598870 CTGTGAATCCATTTGGTACAAGG + Intronic
1041949392 8:63484255-63484277 CTGTGAATTCATCTGGTACAGGG + Intergenic
1042157468 8:65860888-65860910 TTGTGAATGGAAATGCAAAATGG - Intergenic
1042220127 8:66465316-66465338 CTGTTAATGGAAATGTAAAATGG - Intronic
1042701179 8:71616747-71616769 CAGTGTCAGCAAATGGAACAAGG + Intergenic
1043007379 8:74836531-74836553 CAGTGAATATAAATGAAACAAGG + Intronic
1044423411 8:92024664-92024686 CTGGGGATGCAAATGGTTCAAGG - Intronic
1044729806 8:95220714-95220736 CTGAGAAGGGAAATGGGACAAGG - Intergenic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1046593735 8:116236310-116236332 ATGTGAAGGCAAAAGGAAAAAGG - Intergenic
1046914879 8:119669343-119669365 ATGTGAATGCACCTGAAACATGG - Intronic
1047064610 8:121266849-121266871 TTGTCAATGCAAATGGAAGCAGG - Intergenic
1047786685 8:128160298-128160320 CTGTGAGTGGAAATGTAAAATGG - Intergenic
1048658174 8:136566649-136566671 CTCTGAAGGCAACTGGTACAGGG - Intergenic
1053934946 9:43140916-43140938 CTATGAATCCAAATGAAAAATGG - Intergenic
1054961622 9:70976283-70976305 CTGTGAAGGAAAACAGAACAGGG + Intronic
1054965326 9:71019830-71019852 GTGTCAGTGCAAATAGAACAAGG + Intronic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1055608710 9:77998486-77998508 ATGTGAAGTAAAATGGAACATGG - Intronic
1055893022 9:81143299-81143321 CTGTGAAGGCATCTGCAACATGG - Intergenic
1058206194 9:102111368-102111390 CTGTGAATTCACATGGTTCAGGG + Intergenic
1058441589 9:105013102-105013124 CTGTGAATGCATCTGGTCCAAGG + Intergenic
1059727011 9:117018787-117018809 CATTGAATGCACATGGAAAATGG + Intronic
1059991824 9:119872777-119872799 ATGTGAAAGGAAATGAAACAAGG + Intergenic
1061476425 9:130870281-130870303 ATGTACATGCAAAAGGAACATGG - Intronic
1185840755 X:3389046-3389068 CTGAGTATGCAAATGCTACATGG + Intergenic
1186030670 X:5365910-5365932 TTGTGACTGCATATGGAACAGGG - Intergenic
1186175092 X:6918357-6918379 CAGTGAATGCCCATGGAACTGGG - Intergenic
1186813868 X:13216579-13216601 CTGTGAAATCAAATCAAACATGG - Intergenic
1188538042 X:31219167-31219189 CTGTGAACGCATATGGAAACTGG - Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189258274 X:39657499-39657521 CTGTGAATACAAATGGGAACAGG + Intergenic
1192863489 X:75105104-75105126 CTGAGAATGAGAATAGAACAAGG + Intronic
1194041936 X:88952035-88952057 TTGTGCTAGCAAATGGAACAGGG - Intergenic
1194346927 X:92776915-92776937 CTGTGAATCCATATGGTACTGGG - Intergenic
1194510829 X:94792361-94792383 CTGTGAATCCACATGGTACTGGG - Intergenic
1195361873 X:104090196-104090218 CTCTGACTGCAAGTGGAATACGG - Intergenic
1195888159 X:109663269-109663291 CTGTGGATGAAAATGGACAAAGG - Exonic
1197119191 X:122869994-122870016 CTGTGAGTGCCAAAGGGACAGGG + Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197392807 X:125888993-125889015 CTGTGAATCCAACTGGTCCAAGG + Intergenic
1197875357 X:131098193-131098215 AGGTGAATGCAAATTAAACATGG - Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic
1199479699 X:148284605-148284627 CTGACAATGCAAATGGCACTGGG - Intergenic
1201324800 Y:12744658-12744680 ATGGTAATGCAAATGGAACCAGG - Intronic