ID: 1087165911

View in Genome Browser
Species Human (GRCh38)
Location 11:95002035-95002057
Sequence CAGGATTTATTGGCTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087165911_1087165913 -6 Left 1087165911 11:95002035-95002057 CCATGCTCAGCCAATAAATCCTG No data
Right 1087165913 11:95002052-95002074 ATCCTGATACATAGACACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087165911 Original CRISPR CAGGATTTATTGGCTGAGCA TGG (reversed) Intergenic
No off target data available for this crispr