HTGT WGE

Individual CRISPR Summary

ID: 1087165913

 View in Genome Browser
Species Human (GRCh38)
Location 11:95002052-95002074
Sequence ATCCTGATACATAGACACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087165909_1087165913 24 Left 1087165909 11:95002005-95002027 CCAAAGTGCTGGGGTTACAGGTG 0: 1175
1: 72524
2: 207128
3: 250718
4: 204158
Right 1087165913 11:95002052-95002074 ATCCTGATACATAGACACTATGG No data
1087165907_1087165913 28 Left 1087165907 11:95002001-95002023 CCTACCAAAGTGCTGGGGTTACA 0: 34
1: 5763
2: 307639
3: 266488
4: 148583
Right 1087165913 11:95002052-95002074 ATCCTGATACATAGACACTATGG No data
1087165911_1087165913 -6 Left 1087165911 11:95002035-95002057 CCATGCTCAGCCAATAAATCCTG No data
Right 1087165913 11:95002052-95002074 ATCCTGATACATAGACACTATGG No data
1087165910_1087165913 -3 Left 1087165910 11:95002032-95002054 CCACCATGCTCAGCCAATAAATC No data
Right 1087165913 11:95002052-95002074 ATCCTGATACATAGACACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087165913 Original CRISPR ATCCTGATACATAGACACTA TGG Intergenic
No off target data available for this crispr