ID: 1087166801

View in Genome Browser
Species Human (GRCh38)
Location 11:95012783-95012805
Sequence GTCAGGGGCTTAGGAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087166801_1087166809 24 Left 1087166801 11:95012783-95012805 CCAGAATCTCCTAAGCCCCTGAC No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166801_1087166807 -3 Left 1087166801 11:95012783-95012805 CCAGAATCTCCTAAGCCCCTGAC No data
Right 1087166807 11:95012803-95012825 GACTCATCTCCTGGTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087166801 Original CRISPR GTCAGGGGCTTAGGAGATTC TGG (reversed) Intergenic
No off target data available for this crispr