ID: 1087166806

View in Genome Browser
Species Human (GRCh38)
Location 11:95012800-95012822
Sequence TTAGCACCAGGAGATGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087166806_1087166809 7 Left 1087166806 11:95012800-95012822 CCTGACTCATCTCCTGGTGCTAA No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087166806 Original CRISPR TTAGCACCAGGAGATGAGTC AGG (reversed) Intergenic
No off target data available for this crispr