ID: 1087166809

View in Genome Browser
Species Human (GRCh38)
Location 11:95012830-95012852
Sequence CAGAGCTGCACCTCAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087166801_1087166809 24 Left 1087166801 11:95012783-95012805 CCAGAATCTCCTAAGCCCCTGAC No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166805_1087166809 8 Left 1087166805 11:95012799-95012821 CCCTGACTCATCTCCTGGTGCTA No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166804_1087166809 9 Left 1087166804 11:95012798-95012820 CCCCTGACTCATCTCCTGGTGCT No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166808_1087166809 -5 Left 1087166808 11:95012812-95012834 CCTGGTGCTAAAGGTAGACAGAG No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166802_1087166809 15 Left 1087166802 11:95012792-95012814 CCTAAGCCCCTGACTCATCTCCT No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data
1087166806_1087166809 7 Left 1087166806 11:95012800-95012822 CCTGACTCATCTCCTGGTGCTAA No data
Right 1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087166809 Original CRISPR CAGAGCTGCACCTCAGAATT TGG Intergenic
No off target data available for this crispr