ID: 1087166846

View in Genome Browser
Species Human (GRCh38)
Location 11:95013255-95013277
Sequence ATCAAACAAATGTAGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087166842_1087166846 25 Left 1087166842 11:95013207-95013229 CCAAGGAAAATGCAAAAGCAAAA No data
Right 1087166846 11:95013255-95013277 ATCAAACAAATGTAGACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087166846 Original CRISPR ATCAAACAAATGTAGACCAA AGG Intergenic
No off target data available for this crispr