ID: 1087167166

View in Genome Browser
Species Human (GRCh38)
Location 11:95016505-95016527
Sequence CAAGTGCAACAGACCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087167160_1087167166 9 Left 1087167160 11:95016473-95016495 CCAGGGTAGAGTTTCCCACCTTC No data
Right 1087167166 11:95016505-95016527 CAAGTGCAACAGACCTACCATGG No data
1087167165_1087167166 -9 Left 1087167165 11:95016491-95016513 CCTTCAGGGAACAGCAAGTGCAA No data
Right 1087167166 11:95016505-95016527 CAAGTGCAACAGACCTACCATGG No data
1087167163_1087167166 -5 Left 1087167163 11:95016487-95016509 CCCACCTTCAGGGAACAGCAAGT No data
Right 1087167166 11:95016505-95016527 CAAGTGCAACAGACCTACCATGG No data
1087167164_1087167166 -6 Left 1087167164 11:95016488-95016510 CCACCTTCAGGGAACAGCAAGTG No data
Right 1087167166 11:95016505-95016527 CAAGTGCAACAGACCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087167166 Original CRISPR CAAGTGCAACAGACCTACCA TGG Intergenic
No off target data available for this crispr