ID: 1087171014

View in Genome Browser
Species Human (GRCh38)
Location 11:95050328-95050350
Sequence GTGGCTTCACAGTGTAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087171008_1087171014 18 Left 1087171008 11:95050287-95050309 CCATCAACTTTGCCACTCCACGA No data
Right 1087171014 11:95050328-95050350 GTGGCTTCACAGTGTAGCTGTGG No data
1087171010_1087171014 6 Left 1087171010 11:95050299-95050321 CCACTCCACGATGGATTGATTAT No data
Right 1087171014 11:95050328-95050350 GTGGCTTCACAGTGTAGCTGTGG No data
1087171012_1087171014 1 Left 1087171012 11:95050304-95050326 CCACGATGGATTGATTATGGTAA No data
Right 1087171014 11:95050328-95050350 GTGGCTTCACAGTGTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087171014 Original CRISPR GTGGCTTCACAGTGTAGCTG TGG Intergenic
No off target data available for this crispr