ID: 1087173160

View in Genome Browser
Species Human (GRCh38)
Location 11:95070930-95070952
Sequence ATGGGTGTAGAAATTGAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087173160 Original CRISPR ATGGGTGTAGAAATTGAGAA AGG Exonic
900279559 1:1857579-1857601 ATGGGTGGAGTACCTGAGAAGGG + Intronic
900923131 1:5686313-5686335 ACAGGTGTAGAAATTGAGTGTGG + Intergenic
902130952 1:14260039-14260061 AGGAGTGTAGAAATTGAAAACGG - Intergenic
902204313 1:14856188-14856210 ATGGGCATAGAAATTGGGGAGGG + Intronic
902261431 1:15227655-15227677 ATGGATGGAGAAAAGGAGAAAGG - Intergenic
902787832 1:18744738-18744760 ATGGGTGTAGATAGAGTGAATGG + Intronic
904052768 1:27650151-27650173 ATGGATGGATAAATTAAGAAGGG + Intergenic
904824335 1:33264848-33264870 ATGGGGACTGAAATTGAGAAAGG + Intronic
906315158 1:44782166-44782188 AAGGTGGTAGAAATGGAGAATGG - Intergenic
907118248 1:51988632-51988654 ATGGATGAAGAAATTGAGGCAGG + Intronic
907616564 1:55932751-55932773 ATGGGTGGAGAAGGTAAGAAAGG - Intergenic
908154673 1:61340714-61340736 GTGCGTGTATAAATTAAGAAGGG + Intronic
908870341 1:68603372-68603394 AAGGGTCTAGAAATTGACAAAGG - Intergenic
910362617 1:86429206-86429228 ATGGGTGGAGACAGTGAGATGGG + Intronic
912222059 1:107689616-107689638 ATGGGGTTTGAAATTGACAAAGG - Intronic
913178184 1:116294222-116294244 ATGAGTGTAGGAATTAAGAGTGG - Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
914904763 1:151734810-151734832 ATGGGAGAGGAAATGGAGAAAGG + Intergenic
916268352 1:162915146-162915168 TGGGGTGCAGAAATAGAGAAAGG + Intergenic
917344445 1:174014458-174014480 ATGTGGGAAGAAAATGAGAATGG + Intronic
919362735 1:196615046-196615068 GTGGCTGTTGAAATTGAGGAAGG + Intergenic
920763231 1:208806038-208806060 ATTTTTGTAGAAATTGTGAATGG + Intergenic
921784110 1:219206023-219206045 AGAGGTGTTGAAATTTAGAATGG + Intronic
921952984 1:220952900-220952922 ATGGGAGTAGAATTTGAAAAGGG - Intergenic
921962615 1:221051795-221051817 ATCTTTGTAGCAATTGAGAATGG - Intergenic
924651271 1:245929597-245929619 TTGGGTGAAGAAGTTGAGGACGG - Intronic
1063123521 10:3121502-3121524 ACGGGTGGAGAATTTGAGAGCGG + Intronic
1063208192 10:3854777-3854799 ATGCCTGTAGATATTGAAAAGGG + Intergenic
1063826295 10:9901630-9901652 TTGGGTGTAAAAATTAGGAAGGG + Intergenic
1064640635 10:17412073-17412095 GTGGGGGTAGAAGTTGAGACAGG - Intronic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1066053394 10:31658622-31658644 GTGGGTGTGGAAAAAGAGAAAGG + Intergenic
1066283525 10:33941517-33941539 ATGGGTGGAAAGTTTGAGAAAGG - Intergenic
1066642073 10:37564578-37564600 ATAGGTGTAGAAATAGATATAGG + Intergenic
1066699283 10:38109733-38109755 CTGTTTGTAGAAATTGTGAATGG - Intronic
1066993094 10:42535482-42535504 TTGTTTGTAGAAATTGTGAATGG + Intergenic
1070759388 10:79014292-79014314 TTGGATGTAGAAATTGGGAAAGG - Intergenic
1071139476 10:82491053-82491075 ATGGGTGTAGAGAAAGAGAGAGG - Intronic
1073122913 10:101132983-101133005 AGGGGAGCAGAAAGTGAGAACGG - Intronic
1074380729 10:112977990-112978012 CAGGGTTTAGAAATAGAGAAAGG - Intronic
1075048444 10:119164753-119164775 TTAGGTGGGGAAATTGAGAAGGG - Intronic
1075432116 10:122394404-122394426 ATTGGTGTAGAAGTTAAAAATGG + Intronic
1075565751 10:123502711-123502733 ATGGGTGTAAAGATTCAAAATGG + Intergenic
1075786387 10:125052958-125052980 CTGGGGGAAGAATTTGAGAATGG - Intronic
1076733591 10:132449454-132449476 TTGGGAGGAGAAATGGAGAACGG + Intergenic
1078370987 11:10744980-10745002 ATTGGTGTAGAAAATAAGACGGG - Intergenic
1078916209 11:15781248-15781270 ATTGGTGCAGAAAATGAGGAAGG - Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079036764 11:17026725-17026747 ATAGGTGGAGAAACTGAGAGAGG + Intergenic
1080161499 11:29182009-29182031 ATCATTGTAGAAATTGACAAAGG - Intergenic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1085431757 11:76457450-76457472 TTGGGTAGAGAAACTGAGAATGG + Intronic
1086287569 11:85266521-85266543 ATGGGTGTAGCAAATCAGCATGG + Intronic
1087173160 11:95070930-95070952 ATGGGTGTAGAAATTGAGAAAGG + Exonic
1089043861 11:115481660-115481682 ATGGGTGTAGTAACTAAGACAGG - Intronic
1089057565 11:115598920-115598942 AATGGTGAAGAAATTGGGAAAGG + Intergenic
1090147686 11:124343103-124343125 ATTGGAGCAGAAATTGAGTAAGG + Intergenic
1092468215 12:8754319-8754341 ATTGGGTTACAAATTGAGAACGG - Intronic
1092739917 12:11618246-11618268 ATGCCTCTAGAAATTGTGAAAGG + Intergenic
1094087514 12:26609704-26609726 ATGTGGTTAGAAAATGAGAAGGG + Intronic
1098404606 12:70110430-70110452 AAGGGTGAAGAAAATGTGAAAGG + Intergenic
1098863314 12:75733649-75733671 ATGGGCCTAAACATTGAGAAAGG - Intergenic
1099321334 12:81153421-81153443 AAAGGTGAAGAAATTGGGAATGG + Intronic
1099892553 12:88607818-88607840 ACAGGTTTTGAAATTGAGAAAGG + Intergenic
1100154015 12:91775587-91775609 ATATGTGTAGAACTTGATAAAGG + Intergenic
1100873563 12:98938781-98938803 ATGGCTGAAGACATTGACAAAGG + Intronic
1103054582 12:117808676-117808698 AGGGGTGTAGGAGTTGAGGATGG - Intronic
1103778933 12:123386739-123386761 ATGGCAGTAGAAATAGTGAAAGG - Intronic
1105271964 13:18885023-18885045 ATGGGTATATAAACTTAGAATGG + Intergenic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1106859733 13:33892920-33892942 TTGAGTGTAGAAATTGTGAATGG - Intronic
1108294102 13:48995547-48995569 ATTGGTAGAGAAAGTGAGAAGGG - Intronic
1109327905 13:60891977-60891999 ATGGGTGAGGAAGGTGAGAAGGG - Intergenic
1110246060 13:73325978-73326000 ATGGGTGCAGAAAGTCAGCATGG - Intergenic
1110280576 13:73688920-73688942 ATGGATGTAGAAATAGTAAACGG - Exonic
1110522562 13:76498102-76498124 ATGTGTGCAGAAATAGAGGAAGG + Intergenic
1112563435 13:100533151-100533173 ATGGGGGTAGGAGTTGGGAAGGG - Intronic
1114643924 14:24242934-24242956 ATGGGTGAAGACAGTGGGAAAGG - Intergenic
1114764751 14:25358307-25358329 AAAGGTGGAGAAACTGAGAAGGG - Intergenic
1115593937 14:34890959-34890981 ATGGCTGTGGTAATTTAGAATGG - Intergenic
1115597040 14:34919452-34919474 ACAGGTGTTGAAATTGAGCAAGG - Intergenic
1115928703 14:38467012-38467034 AAGGGTGCAGAAATGGACAAAGG - Intergenic
1117406928 14:55412747-55412769 TTGGGTATGGAACTTGAGAAAGG - Intergenic
1118078923 14:62335670-62335692 ATGGATGTATAATTTGATAATGG + Intergenic
1118164311 14:63321103-63321125 CTGGGTGTAGGAAAGGAGAATGG + Intergenic
1118631374 14:67706749-67706771 AAGGGTGGAGAAAATGTGAAAGG - Intronic
1119141261 14:72269384-72269406 ATGGAGGGAGAAAGTGAGAAAGG - Intronic
1121882932 14:97516495-97516517 TTGGGTGTAGGAACTGAGGAGGG - Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1124625454 15:31305035-31305057 CTTGGAGGAGAAATTGAGAAAGG - Intergenic
1125307717 15:38340102-38340124 ATGGGTGTAGCGATTGAGCAAGG + Intronic
1128220808 15:65967158-65967180 ATGCGTGTAAACATTTAGAAAGG + Intronic
1128327979 15:66737513-66737535 ATGGGTGTTGAATTGGAGGAAGG + Intronic
1129315541 15:74741066-74741088 ATGCCTGAAGAAATTGATAAGGG + Intergenic
1133094620 16:3434207-3434229 ATGGGGGATGAAATTGGGAAAGG - Exonic
1134226370 16:12394206-12394228 ATGGGTGAAGAAAATCTGAAAGG - Intronic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1140153573 16:72398981-72399003 ATGTGTGTGAAAATTGATAAAGG + Intergenic
1142710171 17:1718695-1718717 AGGCGTGGAGAAATTGAGCAGGG + Intronic
1143700132 17:8652532-8652554 GTGTGTGTAGAATTTAAGAAAGG + Intergenic
1144227518 17:13164345-13164367 ATGGGTGAGGAATTTGTGAATGG - Intergenic
1144421707 17:15104745-15104767 AGGGGTGGAGGAAGTGAGAATGG - Intergenic
1145271986 17:21409721-21409743 GTTGGTGTAGGAATTGAGACAGG + Intronic
1149287935 17:55186816-55186838 ATGAATGGAGAAAATGAGAAAGG - Intergenic
1149421642 17:56517358-56517380 AGGGATGGAGAAATTGAGATGGG - Intergenic
1151010445 17:70487554-70487576 AGGGGTGAACAAATTAAGAAAGG - Intergenic
1151290125 17:73143870-73143892 ATGGGGGTAGAATCTGAGTAAGG + Intergenic
1152618314 17:81347946-81347968 ATGGGTTTAGAGGCTGAGAAGGG + Intergenic
1153094722 18:1387655-1387677 GTGTGTGTAGCAATTGTGAATGG - Intergenic
1153159343 18:2185485-2185507 ATGGGTGTAGAAGTGGGGATGGG + Intergenic
1153278472 18:3392092-3392114 ATGGGGGTAGAATTTGGGACTGG - Intergenic
1155690224 18:28612263-28612285 ATAAGTTTTGAAATTGAGAATGG - Intergenic
1156065404 18:33137446-33137468 ATAGTTGTAGAAATTTATAATGG - Intronic
1157005675 18:43581126-43581148 ATGGGTGTATAACTTGATCAAGG + Intergenic
1161329167 19:3678255-3678277 AGGGGTGGAGGAATGGAGAATGG + Intronic
1161805824 19:6442379-6442401 ATGGGTGTGCAAGGTGAGAAAGG + Intronic
1163515762 19:17762730-17762752 ATGGGAATAGAGATTGAGAAAGG - Intronic
1164338126 19:24353486-24353508 ATTTTTGTAGAAACTGAGAAGGG + Intergenic
1164361109 19:27511787-27511809 CTGTGTGTAGAATCTGAGAAGGG + Intergenic
1166201441 19:41240095-41240117 ATGGGTGGATATATGGAGAATGG + Intronic
1166600721 19:44092393-44092415 GTGTGTGTATAAATTGAAAACGG - Intergenic
1167275052 19:48532725-48532747 ATGGGTAAAGAAATAGAAAATGG + Intergenic
1167601202 19:50455824-50455846 ATGGATGTAGAAAGGAAGAAGGG - Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
927448057 2:23183215-23183237 CTGGGTTTAGAGATTGGGAAGGG - Intergenic
928272510 2:29869133-29869155 ATGGGTCTGGAATTTGAAAAGGG - Intronic
929297017 2:40259636-40259658 ATGGGTATAAAGATTGAGATGGG - Intronic
930497001 2:52158167-52158189 ATGGGAGAAGAAATTCAGTAAGG + Intergenic
930505675 2:52280594-52280616 ATGGGTGGAGAAATTATTAAAGG + Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
933402870 2:81821015-81821037 TTGCTGGTAGAAATTGAGAATGG - Intergenic
933441279 2:82317684-82317706 ATGGCTAGTGAAATTGAGAAAGG - Intergenic
935694259 2:105757459-105757481 ATGGGTGCAGAGATGTAGAAAGG + Intronic
935898119 2:107759703-107759725 ATGGGTCTAGAAGTAAAGAAGGG + Intergenic
936949686 2:117965479-117965501 ATGGGGTTAGAAATGGAAAAGGG - Intronic
937021987 2:118665568-118665590 AAGGGAGTAGGACTTGAGAAAGG - Intergenic
937309945 2:120895992-120896014 ATGGGTGAGGAAACTGAGATTGG + Intronic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
938998458 2:136705798-136705820 AAGGGTATAGAACTTGAGAGAGG + Intergenic
940139952 2:150483040-150483062 ATGGATGGAGAAAGGGAGAAAGG + Intronic
940376154 2:152961269-152961291 ATGGTTTTATAAAATGAGAATGG + Intergenic
941128070 2:161610987-161611009 TTGGGAGAATAAATTGAGAAAGG + Intronic
941313687 2:163966253-163966275 ATTAATGTAGAAATTGAGATTGG + Intergenic
942189233 2:173454648-173454670 AGGGGTGTAGAAATGGCGGAGGG - Intergenic
942615009 2:177782657-177782679 TTTGGTGTGGAAATTGAGGAGGG - Intronic
942725237 2:178999352-178999374 ATGGGGATGGAAATAGAGAAAGG - Intronic
943797908 2:192021332-192021354 ATAAGTATAGAAATTAAGAAAGG + Intronic
944027552 2:195189794-195189816 ATGGCTTTAAAAATAGAGAAAGG + Intergenic
945020278 2:205564061-205564083 ATGGATGAAGAAACTGAGACTGG + Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
945745175 2:213712008-213712030 ATTTGTGTAGATAATGAGAATGG - Intronic
947372964 2:229467157-229467179 TTGGGAGTAGAAAGTGAGGAAGG + Intronic
1169789335 20:9392926-9392948 ATGGGTGGAGGAATGGGGAATGG + Intronic
1169998280 20:11584067-11584089 AGGGGAGCAGAAATTGAGACAGG + Intergenic
1172685197 20:36748532-36748554 CTGGGTGGAGAAATCGAGACTGG - Intergenic
1173300731 20:41800140-41800162 ATGGTTGAAGCAACTGAGAATGG + Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1177299071 21:19217320-19217342 TTGGGGGTAGAAATTAAGCATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178296622 21:31415672-31415694 AAGGGTGTAGAAGCTGAGAATGG - Intronic
1180121946 21:45758227-45758249 ATAGGTTTTGAAATTGACAAGGG + Intronic
1181848491 22:25732555-25732577 ATGGGTCTGTAATTTGAGAAGGG + Intergenic
1181959004 22:26609601-26609623 ACGTGTGTATAAATGGAGAATGG + Intronic
1183516697 22:38271015-38271037 TTGGTTGGAGAAATTCAGAAGGG + Intronic
1184949515 22:47830635-47830657 ATGGGTGGAGAATTTGACAATGG + Intergenic
949149167 3:743903-743925 ATGGGAGTAAATATTGAGTAGGG + Intergenic
951756785 3:26099452-26099474 ATTGGTGGAGAAATTGAAATAGG - Intergenic
952156275 3:30647027-30647049 AGGGGTGTTGATAATGAGAAGGG + Intronic
952462673 3:33545571-33545593 CTCAATGTAGAAATTGAGAAAGG + Intronic
952846276 3:37690447-37690469 ATGAGTGCAGAAATCCAGAATGG - Intronic
953195234 3:40726084-40726106 ATGGGAGTAGAACTAGAGAAAGG + Intergenic
953430828 3:42839057-42839079 AGGTGTGGAGAAAATGAGAAAGG - Intronic
953479952 3:43242856-43242878 ATGGGGGCAGAAACTCAGAAGGG + Intergenic
955109028 3:55929375-55929397 CTGCTTGGAGAAATTGAGAAGGG - Intronic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
957005478 3:74940930-74940952 ATGTGTAAATAAATTGAGAAGGG + Intergenic
957122196 3:76109362-76109384 ATGGGTTTGAAAATTTAGAAGGG + Intronic
957840748 3:85666132-85666154 CTGTTTGTAGAAATTGTGAATGG - Intronic
959069535 3:101689489-101689511 ATGGGTGACGAAACTGTGAAGGG - Intergenic
959555466 3:107712276-107712298 ATGGAGGTAGAAATTAAGATTGG - Intronic
959560177 3:107770449-107770471 AGGGCTATAGAAGTTGAGAAAGG + Intronic
960321662 3:116244216-116244238 ATTGCTGGAGAAGTTGAGAAAGG - Intronic
960447990 3:117771272-117771294 ATGGGTCTTGAGATTCAGAAAGG + Intergenic
960744930 3:120876815-120876837 ATGAGTGTGGAAAATGAGACAGG + Intergenic
961208403 3:125106129-125106151 ATGGGACTGGAAATAGAGAAGGG + Intronic
961872276 3:129997305-129997327 GTGGGTGTATAAATTGGGAGCGG - Intergenic
962842851 3:139251488-139251510 ATGGATGTAGACCTTTAGAAAGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
964120200 3:153175243-153175265 ATGTCTGTATAAATTGAAAATGG + Intergenic
964783146 3:160363255-160363277 ATCTGTGTAGCAATTGTGAATGG - Intronic
964962850 3:162449422-162449444 ATCTGTGTAGCAATTGTGAATGG + Intergenic
965903371 3:173671643-173671665 ATGGGTGGAGAAAAAGAGTAAGG - Intronic
966330007 3:178801042-178801064 ATGGAGGGAGAAAATGAGAATGG + Intronic
967568142 3:190995166-190995188 ATGGGTGTGCAATTTGATAATGG - Intergenic
967580997 3:191154012-191154034 ATGGAAATAGAAATAGAGAAGGG - Intergenic
969267714 4:6075846-6075868 ATGGGAGGAGAAATTCACAAAGG - Intronic
970163201 4:13209790-13209812 CTGGGTGTTGAAAGTGAAAAGGG - Intergenic
970598891 4:17625200-17625222 ATGGGTGTAGAATTAGTGAGGGG - Exonic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
972877423 4:43380581-43380603 ATGAGATTAGGAATTGAGAAAGG - Intergenic
973030824 4:45335932-45335954 ATATGTTTAGAAATTCAGAATGG + Intergenic
974125177 4:57687459-57687481 CTGGGTCTAGAATTTGAGCAGGG + Intergenic
974766273 4:66350322-66350344 ATGAATGAAGAAATTAAGAAGGG + Intergenic
978826915 4:113035768-113035790 AGGGGTGGAGCAATAGAGAATGG + Intronic
979711253 4:123782004-123782026 ATGGGGGTAGAAATTTTGAGTGG + Intergenic
980782953 4:137515247-137515269 AGGGGTGAGTAAATTGAGAAGGG - Intergenic
981862520 4:149374471-149374493 ATGGGTGAAGTTACTGAGAAAGG - Intergenic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982541365 4:156675824-156675846 AGGGGTTCAGAAATTGAAAAGGG + Intergenic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983397162 4:167213663-167213685 ATTGGTGTTGAAATTGATCATGG - Intronic
983953824 4:173674248-173674270 ATGGGTGTTGAAATAAAGGAAGG + Intergenic
986135135 5:4969786-4969808 ATGGGGGGAGAGATAGAGAAAGG + Intergenic
986630141 5:9763919-9763941 ATGTTTGTAGAAATTCAGAAAGG + Intergenic
986878182 5:12136575-12136597 GTGTGTGCAGAAATTGTGAATGG - Intergenic
987436202 5:17896656-17896678 ATGGGTGAATAAATGGGGAAGGG - Intergenic
988787836 5:34580567-34580589 ATTTGTGTTGAAATTCAGAAGGG + Intergenic
988918946 5:35923018-35923040 GTGGGTTTAGAGAATGAGAAGGG - Intronic
989429995 5:41341979-41342001 ATAGTTGTAGAAAATGAGACTGG + Intronic
989737141 5:44721433-44721455 CTAGGTCTAGAAATTGAGCAAGG + Intergenic
990288417 5:54324604-54324626 ATGGATGTAAACCTTGAGAAAGG + Intergenic
990605340 5:57403861-57403883 AGATGTGTAGAAATTGATAAGGG + Intergenic
993894470 5:93515891-93515913 TTGGTTGTAGATATTGATAAGGG - Intergenic
994056330 5:95420868-95420890 ATATGTGTAGGTATTGAGAATGG + Intronic
995417116 5:111924195-111924217 ATTGGCTAAGAAATTGAGAAGGG + Intronic
995869426 5:116728909-116728931 ATGGGAGTAGGAGTGGAGAAAGG + Intergenic
997218275 5:132133458-132133480 ATTGGAGAAGAAACTGAGAAAGG - Intergenic
997259007 5:132451369-132451391 ATGGGTGAAGGAAAAGAGAAGGG + Intronic
998292752 5:140930618-140930640 AGGTGTGTAGAAATTAAGGAAGG + Intronic
998330142 5:141318328-141318350 AGGGGTAAAGAAATTGGGAATGG - Intergenic
998374647 5:141682499-141682521 ACGGAGGTAGAAACTGAGAAAGG + Intergenic
998532794 5:142901033-142901055 AGATGTGTAGAACTTGAGAAGGG + Intronic
1000962935 5:167621583-167621605 TTGGGTGTAGGAATGGAGAAAGG + Intronic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1002816182 6:682722-682744 ATGGATGCAGAAAGTGGGAAAGG + Intronic
1003942194 6:11041158-11041180 CTGGGAGTAGACATTGATAAGGG - Intronic
1004143661 6:13045207-13045229 AGAGCTGGAGAAATTGAGAAGGG - Intronic
1004797624 6:19105472-19105494 ATGTGTGTGGAAATTGTGAATGG - Intergenic
1006544114 6:34765053-34765075 AAGGGTGAGGAAATTCAGAATGG - Intronic
1006660801 6:35642266-35642288 ATAGATGTTGAAATTGAGACTGG - Intronic
1006849382 6:37086593-37086615 ATGGGTGTAGAATTTCAGTTTGG - Intergenic
1008395054 6:50996474-50996496 ATGTCTGTAGACATTGACAAGGG + Intergenic
1010833131 6:80555127-80555149 ACAGGTGTAGAAATTCTGAATGG + Intergenic
1011739933 6:90349523-90349545 AGGGGTATGGAAATAGAGAAGGG - Intergenic
1011873316 6:91925005-91925027 ATGGGTGTTTGAACTGAGAAGGG + Intergenic
1011935154 6:92768030-92768052 ATAGGTTTAGAAAATGACAAAGG + Intergenic
1012580127 6:100857847-100857869 GTGTGTGTGGAAATTGACAAGGG - Intronic
1012936446 6:105372853-105372875 ATGGGTGGAGAAATAGATACAGG - Intronic
1014878871 6:126696740-126696762 ATGGATGAAAAAATTGAAAAAGG - Intergenic
1015054727 6:128886521-128886543 ATGGGTGTAGATGCAGAGAAGGG + Intronic
1015382289 6:132583270-132583292 CAAGGTGTGGAAATTGAGAAAGG + Intergenic
1015627486 6:135195712-135195734 AAGGGTGTAGAAATAAAGAGAGG - Intronic
1015647651 6:135411919-135411941 GTGTGTGTAAAAATTAAGAAGGG - Intronic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1016763883 6:147771002-147771024 ATAGTTGTAGAATTTTAGAAAGG - Intergenic
1016930272 6:149399712-149399734 ATGTGTGTAGAAATGGAAACAGG + Intronic
1017142977 6:151208439-151208461 ATGGGTGTGGACTTTGTGAAGGG - Intergenic
1020612649 7:10419661-10419683 ATGGATGTAGGAATTGAGAAAGG - Intergenic
1023268127 7:38430305-38430327 ATGGGTGTTTAGATGGAGAATGG + Intronic
1024461060 7:49659953-49659975 ATGGGTGTAGAAATTGGTATAGG - Intergenic
1025595276 7:62915737-62915759 GTTGGTGTAGAATATGAGAAGGG + Intergenic
1028306420 7:89270816-89270838 ATGTTTGAAGAAATTGTGAATGG + Intronic
1028330173 7:89580418-89580440 TTGGGCCTAAAAATTGAGAATGG + Intergenic
1029645161 7:101850364-101850386 TTGGGTGTAGGAAATGAGAGTGG - Intronic
1030839104 7:114326397-114326419 ATGGGTTTAGAAAAAGTGAATGG + Intronic
1031540828 7:122992725-122992747 ATATGTGTATAAATAGAGAACGG - Intergenic
1032063317 7:128743831-128743853 GTGGGTGAGGAAAATGAGAAGGG + Intronic
1032951764 7:136922535-136922557 ATGTGTGTAGACATAGAGTATGG - Intronic
1033740833 7:144274624-144274646 ATGGGTTAAGCCATTGAGAAGGG + Intergenic
1033753073 7:144374989-144375011 ATGGGTTAAGCCATTGAGAAGGG - Intronic
1036616932 8:10395381-10395403 ATGTGTGTAGAAAGAGAGTAGGG + Intronic
1037927809 8:22858183-22858205 GTGGGTGTTGAAATGGTGAAAGG + Intronic
1038385141 8:27136993-27137015 ATGTGTGAATAAATTGATAAAGG - Intergenic
1038627121 8:29204978-29205000 ATAGGTGTAGAAAAGGTGAAGGG - Intronic
1039820390 8:41129409-41129431 ATTGGTATAGAAATTCTGAAGGG + Intergenic
1040987257 8:53309368-53309390 ATGGGTATGGATATGGAGAAAGG - Intergenic
1041731584 8:61068560-61068582 AGGGGAGCAGGAATTGAGAATGG - Intronic
1042060780 8:64814930-64814952 ATGGGAGTAGATCTTGAGGAAGG + Intergenic
1042128711 8:65565261-65565283 ATAGGTGTAGAAATACTGAATGG - Intergenic
1042155879 8:65842777-65842799 ATGGGTGAAAAGAATGAGAAAGG + Intergenic
1042413989 8:68498256-68498278 ATGGGGGTAGAAATAAAGAAAGG + Intronic
1042497619 8:69472429-69472451 ATGGGTGCAGAGTTTGGGAATGG - Intronic
1042694672 8:71543707-71543729 TTAGGTGTAGAAATGAAGAAGGG + Intronic
1042819799 8:72917604-72917626 AATGGTGTTGAAATTGGGAAAGG + Intronic
1043277985 8:78424827-78424849 ATGGATCTAGAAATTGATAAAGG - Intergenic
1043459062 8:80441263-80441285 AAGGGTATAAAAATTGGGAATGG + Intergenic
1044098846 8:88103565-88103587 ATGGTTGTAGAAGTTGATGATGG - Intronic
1044268964 8:90217321-90217343 ATTGCTGAAGAAAGTGAGAATGG - Intergenic
1044572726 8:93737682-93737704 ATGGGTGTATAAATTTATCAAGG + Intronic
1045701375 8:104870662-104870684 AAGGGTGAGGAAATTCAGAAGGG + Intronic
1048494632 8:134925029-134925051 ATGGGTGTACAAAAGAAGAAAGG - Intergenic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1048832413 8:138489702-138489724 GTGGGTGAAGAACTTGAGACAGG - Intronic
1050336000 9:4590586-4590608 CTGGTTGGAGAAAATGAGAAAGG + Intronic
1053475493 9:38379293-38379315 ACAGCTTTAGAAATTGAGAAAGG + Intergenic
1055900209 9:81225385-81225407 ATGGTTGTAGATATTCAGAAAGG - Intergenic
1056008174 9:82296396-82296418 AGGGGTGAAGCAAGTGAGAAAGG + Intergenic
1056147907 9:83752546-83752568 CGGGGTGTGGAAAATGAGAATGG + Intronic
1057315017 9:93962577-93962599 ATGGGTGTAGGAAATGAGTCAGG - Intergenic
1058103244 9:100939587-100939609 ATGTGATTAAAAATTGAGAATGG + Intergenic
1058197976 9:102001973-102001995 GTGGGATTAGAAATAGAGAAGGG + Intergenic
1059882150 9:118703408-118703430 ATGGTGGTAGAAGTGGAGAATGG - Intergenic
1059995151 9:119901870-119901892 ATCTTTGTAGAAATTGTGAATGG + Intergenic
1060180787 9:121532237-121532259 TTGGGTGTGGAAATAGAAAATGG + Intergenic
1060273484 9:122164679-122164701 AAGGGTGTAGAACTTGAATATGG + Intronic
1061147768 9:128809644-128809666 ATGGGTATAGGAAGGGAGAAAGG + Exonic
1186892404 X:13971920-13971942 ATGGATATTGAGATTGAGAATGG - Intergenic
1187105690 X:16239194-16239216 ATGGATGAAGAAACTAAGAAAGG - Intergenic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1189144312 X:38640069-38640091 ATGGGTTTTGAAATGGAGCAAGG + Intronic
1189745429 X:44163488-44163510 ATGGGTGAAACAATAGAGAATGG - Intronic
1190498093 X:51046567-51046589 TTAGGTCTAGAAATTGTGAAAGG - Intergenic
1190982840 X:55471973-55471995 ATGGGTGTAGAAATTTGGGGTGG + Intergenic
1190985859 X:55501210-55501232 ATGGGTGTAGAAATTTGGGGTGG - Intergenic
1191582073 X:62774333-62774355 ATTCGTGTAGAATTTGTGAATGG - Intergenic
1191582362 X:62778230-62778252 ATTTTTGTAGAATTTGAGAAGGG - Intergenic
1191614620 X:63155751-63155773 CTTTGTGTAGAAATTGTGAATGG - Intergenic
1191621676 X:63223175-63223197 CTTTGTGTAGAAATTGTGAATGG + Intergenic
1191666121 X:63704584-63704606 ATGGGTGAATAAATTTAAAAAGG + Intronic
1192422070 X:71042621-71042643 ATGGCTGTAGTAATTGAGTGAGG - Intergenic
1192598259 X:72434617-72434639 ATAAGTGTAGAAACTGAGTATGG - Intronic
1193658826 X:84231996-84232018 TTGATTGTATAAATTGAGAAGGG + Intergenic
1194821695 X:98515339-98515361 TTGGGTGTTTAAATTGAGAAGGG + Intergenic
1194908687 X:99611368-99611390 ATGTGGGTAGGAATTGTGAATGG - Intergenic
1195156155 X:102126093-102126115 ATGGGTGTAGATTGTGAGAAGGG - Intronic
1195994333 X:110716636-110716658 ATGGGTGGAGAAATTAGGGATGG + Intronic
1196112083 X:111957052-111957074 ATGACTGAAGAAACTGAGAATGG - Intronic
1196279093 X:113801762-113801784 ATGGAAGTAGCACTTGAGAAGGG + Intergenic
1196541586 X:116916879-116916901 AAGGGTGGAGAAAGGGAGAAGGG - Intergenic
1199862854 X:151817537-151817559 AAGAGTGTGGAAAGTGAGAAGGG - Intergenic