ID: 1087175158

View in Genome Browser
Species Human (GRCh38)
Location 11:95089616-95089638
Sequence GCTGAGACCAGGCGGCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087175144_1087175158 25 Left 1087175144 11:95089568-95089590 CCGCCCCACTCGGATTCTCCACT No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1087175149_1087175158 7 Left 1087175149 11:95089586-95089608 CCACTCTTGGTAGCGCGCGTCCC No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1087175146_1087175158 21 Left 1087175146 11:95089572-95089594 CCCACTCGGATTCTCCACTCTTG No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1087175145_1087175158 22 Left 1087175145 11:95089571-95089593 CCCCACTCGGATTCTCCACTCTT No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1087175147_1087175158 20 Left 1087175147 11:95089573-95089595 CCACTCGGATTCTCCACTCTTGG No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120
1087175143_1087175158 26 Left 1087175143 11:95089567-95089589 CCCGCCCCACTCGGATTCTCCAC No data
Right 1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087175158 Original CRISPR GCTGAGACCAGGCGGCGCGG AGG Intergenic