ID: 1087175363

View in Genome Browser
Species Human (GRCh38)
Location 11:95090450-95090472
Sequence CCTTCACTTCATGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087175354_1087175363 25 Left 1087175354 11:95090402-95090424 CCTGCCTCGCCCCTGTCGAGCTA 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1087175355_1087175363 21 Left 1087175355 11:95090406-95090428 CCTCGCCCCTGTCGAGCTACAAT 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1087175357_1087175363 15 Left 1087175357 11:95090412-95090434 CCCTGTCGAGCTACAATAAGAGC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1087175356_1087175363 16 Left 1087175356 11:95090411-95090433 CCCCTGTCGAGCTACAATAAGAG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1087175360_1087175363 -7 Left 1087175360 11:95090434-95090456 CCTGGCGATCTGCGAGCCTTCAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1087175358_1087175363 14 Left 1087175358 11:95090413-95090435 CCTGTCGAGCTACAATAAGAGCC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087175363 Original CRISPR CCTTCACTTCATGAGCTGCA GGG Intronic
905280146 1:36843942-36843964 CCTTGACCTCATGAGCCCCAGGG + Intronic
905685560 1:39905042-39905064 CCTTGACTTCCTGGGCTCCAGGG + Intergenic
906734255 1:48109207-48109229 AAGTCACTTCATGAGCTGGAGGG - Intergenic
909480442 1:76124245-76124267 CCTCCATTTCATCAGCAGCAAGG - Intronic
911511734 1:98815570-98815592 CCTTCACTTAATAAGCTTCTGGG + Intergenic
911523608 1:98958840-98958862 ACTCCACTTCATGAGCTGACCGG + Intronic
911812520 1:102301177-102301199 TCTACACTTCATGAGATGCAAGG - Intergenic
912475618 1:109932819-109932841 CCTGGGCTTCATGTGCTGCAGGG + Intergenic
912739927 1:112184826-112184848 CCTTCACTTTGAGTGCTGCATGG + Intergenic
913521008 1:119646413-119646435 CCTTCACTTCATTATCCTCATGG + Intronic
917815617 1:178706947-178706969 TCTTGTCTTCATGAGCTGCATGG + Intergenic
917939414 1:179903211-179903233 CCTTCAGTTCATGACCAGCCTGG + Intronic
918081978 1:181214739-181214761 CCTTCACCTCATGCTCTGCCTGG + Intergenic
918778653 1:188668811-188668833 CCTTCCCTTCATGAACTGAGAGG + Intergenic
919607030 1:199695644-199695666 CCCTCACTCCCTGGGCTGCATGG + Intergenic
920046598 1:203136724-203136746 CCTACACAACCTGAGCTGCATGG - Intronic
920546732 1:206824371-206824393 CCATCACTTTATGATCTCCAGGG - Intronic
920630437 1:207646341-207646363 GCTTCAGTTTATGAGCTGTAGGG - Intronic
922175618 1:223195036-223195058 CCTTCACTTCATGAGATAAGGGG - Intergenic
1065892335 10:30131929-30131951 CCATCTCTTAATGAACTGCAAGG + Intergenic
1067053765 10:43039794-43039816 CCTTCCCTGGCTGAGCTGCATGG - Intergenic
1067785165 10:49240436-49240458 CCTTTACTTCTTAAGCTGCCTGG + Intergenic
1068443447 10:57089746-57089768 CCTTCACTCCCTCAGCTACATGG - Intergenic
1069963361 10:72092469-72092491 CCCTCTCTTCATGGCCTGCAGGG + Intergenic
1070109919 10:73475585-73475607 CCTTCCCTTCATGGGCAGCATGG - Intronic
1074229186 10:111516812-111516834 GGTTCCCTTCAGGAGCTGCATGG - Intergenic
1074231229 10:111537920-111537942 CCTCCACTTCAGGAGCTCCATGG - Intergenic
1074405690 10:113178577-113178599 CCGTCATTTCATGAGCTCCAGGG + Intergenic
1076002318 10:126922131-126922153 CCTCCACTTCCTGGGCTCCAGGG - Intronic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1077705808 11:4484195-4484217 CCTTCACTTCATGATATGGTGGG + Intergenic
1078091564 11:8267717-8267739 CCTAAACTTCATTAGCTTCAAGG + Intronic
1081748641 11:45491017-45491039 CCTTCCCCTAATGTGCTGCAGGG + Intergenic
1081795978 11:45819971-45819993 CCTACATATCATGAGCTACAGGG - Intergenic
1083071955 11:59993738-59993760 CCAGCACTTCCTTAGCTGCATGG + Intergenic
1084891294 11:72238334-72238356 CTATCACTTGCTGAGCTGCAGGG - Exonic
1086608013 11:88720349-88720371 CCTTCACTTAATTGTCTGCAAGG - Intronic
1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG + Intronic
1088490398 11:110381397-110381419 CCTCCACTTCCTGGGCTGAAGGG + Intergenic
1091162203 11:133434346-133434368 ACTTAACTTCAGAAGCTGCAGGG - Intronic
1093084526 12:14851931-14851953 CCTTGACTTCTTGAGCTCAACGG - Intronic
1094190823 12:27696649-27696671 CCTTCAGTTTCTGAGCTGCATGG - Exonic
1097283644 12:57861388-57861410 CCTTGACTTCCTGGGCTCCAGGG + Intergenic
1097449299 12:59716214-59716236 CATTGACTGCATGAGATGCAAGG - Intronic
1098111504 12:67126720-67126742 CCTTAACTTTATCAGCTGCTGGG + Intergenic
1100311097 12:93395309-93395331 CATTTACTTCATCAGCGGCAAGG - Intronic
1102356516 12:112241371-112241393 CCATCACCTCAAGAGCTGCCAGG - Intronic
1106247917 13:27964618-27964640 CCCTGACTTCCTGAGCTGAAGGG - Intronic
1106567297 13:30897451-30897473 TCTTCACTGCATCAGCTGTATGG + Intergenic
1107354526 13:39552746-39552768 CCTTCACTTCAGAAGCTTCATGG - Intronic
1110909348 13:80936282-80936304 CCTCCACTTCCTGGGCTGAAAGG + Intergenic
1113627055 13:111855179-111855201 CCTTGACCTCCTGAGCTCCAGGG + Intergenic
1115254281 14:31382019-31382041 CATTGACTGTATGAGCTGCAGGG - Intronic
1118694464 14:68370919-68370941 CCTCCACTTCCTGAGCAGCTGGG - Intronic
1119171085 14:72536909-72536931 CCATGACTCCATGGGCTGCAAGG - Intronic
1126185927 15:45830229-45830251 CCTTCATTTCAGGACCAGCATGG + Intergenic
1127420178 15:58797390-58797412 CCTTAACCTCCTGAGCAGCAGGG - Intronic
1127435672 15:58955733-58955755 CCTTGACCTCATGAGCTCCAGGG - Intronic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG + Intronic
1138389525 16:56659991-56660013 CCTTCAATTCCTGAGCTAGATGG - Intronic
1140580636 16:76227267-76227289 CCTCTACTTCATGAGGGGCAGGG - Intergenic
1141143391 16:81512508-81512530 GCTTCACTTCATCAGCTACATGG + Intronic
1142431932 16:90033580-90033602 CCTTGACTTCCTGAGCTCAAGGG - Intronic
1144819182 17:18059464-18059486 CCCTCATTTCCTGAGCTGGAGGG - Intronic
1147433608 17:40391617-40391639 CCTTAACATCATCAGCTTCAAGG + Exonic
1151466730 17:74290414-74290436 CCTTTAATTCATGGCCTGCAGGG + Intronic
1158479385 18:57806731-57806753 CCTTCACTTCCTGGGCTCAAAGG - Intergenic
1158886284 18:61830103-61830125 CCTTCACTTCACGGGTTCCAGGG + Intronic
1163818240 19:19481054-19481076 CCTTCAGTTCATTTGCTGTAGGG + Intronic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
1167142562 19:47662033-47662055 CCTTGACTTCCTGGGCTCCAGGG - Intronic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
928874884 2:36026367-36026389 CCTTCACTTCCTGAGTAGCTGGG - Intergenic
929810303 2:45183934-45183956 GCTTGACTTCATCAGCTGTAGGG + Intergenic
932589915 2:73059121-73059143 CCTGCACTTCAGCAGCTACAGGG - Intronic
933609085 2:84415514-84415536 CCTTCACATCCTGGGCTCCAGGG + Intergenic
935198058 2:100832133-100832155 CCTACCCTACATGAGGTGCAGGG - Intronic
935394256 2:102588733-102588755 CCAGCACTTCATGATCTCCACGG - Intergenic
935745128 2:106183708-106183730 ACTTCACTTGATGAGCTTCAAGG - Intronic
937759970 2:125589423-125589445 CTTACACTTCATGGCCTGCAGGG + Intergenic
938639801 2:133266590-133266612 CCTTCACTTCGGGGGCAGCAAGG + Intronic
942132173 2:172891261-172891283 TCTTCCCTTCATGAGTTTCATGG + Intronic
945326644 2:208489815-208489837 CCCTAACTTAATGAGCTACATGG - Intronic
1172114735 20:32567000-32567022 CCTTCACTTCCTGTGCAGCCTGG - Intronic
1174176813 20:48650484-48650506 CCCTCAGTTCATGAGGTTCAGGG + Intronic
1176012825 20:62909050-62909072 CTTGCACTGCATTAGCTGCAAGG - Intronic
1179325244 21:40336120-40336142 CCTCCACCTCCTGAGCAGCACGG + Intronic
1179479749 21:41669670-41669692 CCTTCCCATCGTGACCTGCAGGG + Intergenic
1182535845 22:31002408-31002430 CCTTCCCTTCATTAGCTGTCTGG - Intergenic
1183823134 22:40363197-40363219 CCTTCAGTTCATAAGCTCTAGGG + Intronic
949392937 3:3582891-3582913 CCTTGAGGTCCTGAGCTGCAAGG + Intergenic
951504207 3:23423921-23423943 CCTTCAATTCATGATCCTCAGGG + Intronic
952031995 3:29154196-29154218 TCCTCACTTAATGTGCTGCAAGG + Intergenic
953002425 3:38948031-38948053 CCTTCCTTTAATGAGCTGCTGGG + Intronic
953304411 3:41813782-41813804 CCTTCACTGCATGAAAGGCAAGG - Intronic
953931489 3:47008015-47008037 CCTTCATTTCCTGAGCCTCAGGG + Intronic
955864922 3:63372267-63372289 CCTTCACTTGGTGAGAAGCAGGG - Intronic
956662301 3:71611109-71611131 CCTTCCCATCATGAGATCCAAGG + Intergenic
960718667 3:120603796-120603818 CCTCCACTTCATGCGCTGCTTGG + Intergenic
962218575 3:133543663-133543685 TCTTCACTTAATCATCTGCAAGG + Intergenic
962908698 3:139828097-139828119 CCTTCACTTCAGCAGCAGCTGGG - Intergenic
963466411 3:145687678-145687700 CCTTCACATCTTGAGAGGCATGG - Intergenic
964787387 3:160413047-160413069 CCTCCACTTCATGAGTAGCTGGG + Intronic
969180149 4:5434167-5434189 CTTTCACTGCATGGGGTGCATGG - Intronic
970051045 4:11915614-11915636 CCTTCACTTAATCACATGCACGG - Intergenic
970831892 4:20349417-20349439 CCCTCACTTCCTGTTCTGCATGG + Intronic
971843283 4:31882805-31882827 CTTTCTCTTCATGAATTGCAAGG - Intergenic
975316328 4:72957093-72957115 CCTTCACTTCAAGAGAGGAATGG + Intergenic
985053888 4:186019350-186019372 CCTTCACCTCAAGAACTTCATGG + Intergenic
985917066 5:2930239-2930261 CTTTATCTTCATCAGCTGCACGG + Intergenic
988346752 5:30046960-30046982 CCTTCACTTCTTTAGAAGCAAGG + Intergenic
988698316 5:33646545-33646567 TGTTGACTTCATGAGCAGCATGG - Intronic
991263372 5:64690325-64690347 CCCTCACTTCATCAGCAGCCTGG - Exonic
992524482 5:77594720-77594742 CCTTCACTGTCTGAGCTACAGGG + Intronic
992965544 5:81996319-81996341 CCTTGACTTCCTGGGCTGAAGGG + Intronic
994956894 5:106544418-106544440 CCTCCACTTCAGGAGCTCCTTGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997070501 5:130617056-130617078 CCTTCATTTCATGATCATCAAGG + Intergenic
998456612 5:142278715-142278737 CTTTCACTTCATGGCCCGCATGG + Intergenic
998792092 5:145776976-145776998 CCTTCACTTGGTGAACTGCAAGG + Intronic
1003376858 6:5587755-5587777 CCTTAAGTTCATGAGCTCCGGGG + Intronic
1006068527 6:31479822-31479844 CCTTCACCTCATGAGCCAGATGG - Intergenic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1007844583 6:44742726-44742748 CCTTCACCTTAACAGCTGCAAGG + Intergenic
1016388273 6:143549674-143549696 CCTCCCCTTCCTGAGCTGCCTGG + Intronic
1018420893 6:163640567-163640589 GCTTCCCCTCGTGAGCTGCATGG + Intergenic
1023579849 7:41670168-41670190 CCTTCACTGCATGAGATGTAAGG - Intergenic
1026595695 7:71732628-71732650 CCCGGATTTCATGAGCTGCAGGG + Intergenic
1026680009 7:72459540-72459562 CCTCCACTTCCTGGGCTGAAGGG - Intergenic
1029295624 7:99538183-99538205 CCTTGACCTCCTGAGCAGCAGGG + Intergenic
1029539653 7:101175068-101175090 CCTTCACCTCCTGAGTTGCTGGG + Intronic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1032527674 7:132592064-132592086 CTTTCACCTCATGAGCTGGCGGG - Intronic
1037636301 8:20703724-20703746 CCTTTACCTCCTGAGCTGAATGG - Intergenic
1038735438 8:30164773-30164795 CCATCACTTCCTGGCCTGCAGGG - Intronic
1038781712 8:30573830-30573852 CGTTCACTTTGTGAACTGCAAGG - Intergenic
1047071504 8:121349158-121349180 CCTTCAGTTGGAGAGCTGCAGGG + Intergenic
1047462931 8:125086049-125086071 CCTTCACTTAAGGTGCTGTATGG - Intronic
1048029156 8:130614537-130614559 CCATTACTTAATGAGATGCAGGG + Intergenic
1049870813 8:144974291-144974313 CCTCAACTTCATGAGTAGCAGGG - Intergenic
1053534053 9:38908254-38908276 CCCTGTTTTCATGAGCTGCAGGG - Intergenic
1053662390 9:40292793-40292815 CCTCCACTTCATCAGCTGTCAGG - Intronic
1054206277 9:62132673-62132695 CCCTGTTTTCATGAGCTGCAGGG - Intergenic
1054522220 9:66083491-66083513 CCTCCACTTCATCAGCTGTCAGG + Intergenic
1054632080 9:67455673-67455695 CCCTGTTTTCATGAGCTGCAGGG + Intergenic
1055235922 9:74123153-74123175 CCTTCACTTCAAGCCCAGCATGG - Intergenic
1055826846 9:80337810-80337832 ACTTCATTTTATGAACTGCAAGG + Intergenic
1056944735 9:90984630-90984652 CTTTAAGTCCATGAGCTGCAGGG - Intergenic
1058848955 9:108991616-108991638 CCTGAACTTCCTGAGCTGCCAGG - Intronic
1060081755 9:120654136-120654158 CATTACCTGCATGAGCTGCAGGG + Intronic
1060305477 9:122406947-122406969 CCTTGACTTCCTGAGCTCAAGGG + Intergenic
1060620737 9:125063291-125063313 CCTTCACTTCCTGAGTGGCTGGG - Intronic
1186272127 X:7900278-7900300 CCTTCAGTTCCAGAGCTACAGGG + Exonic
1192213676 X:69143273-69143295 CCTACACTTGGTGAGTTGCAGGG - Intergenic
1195135581 X:101904588-101904610 CAGTAACTTCATGAGCTTCATGG + Intronic
1200966996 Y:9056253-9056275 CCTTAAGTTCATGGGGTGCATGG - Intergenic