ID: 1087175514

View in Genome Browser
Species Human (GRCh38)
Location 11:95091527-95091549
Sequence GGGAACACCCTGTGAGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087175514 Original CRISPR GGGAACACCCTGTGAGCTCT AGG (reversed) Intronic
900241086 1:1617838-1617860 GGGCACAGCCTGTGAACTGTGGG + Intronic
901784821 1:11617555-11617577 GGACACACCCTGTTAGCTTTAGG + Intergenic
902120611 1:14162108-14162130 GGATCCACCCTTTGAGCTCTTGG + Intergenic
902180893 1:14687510-14687532 GGGAAAAGCGTGTGTGCTCTGGG + Intronic
902207128 1:14877122-14877144 GGGAACACCCCTTGAGCTCCTGG - Intronic
902411212 1:16212547-16212569 CGGGACACCCTGGGGGCTCTGGG + Exonic
904319073 1:29684815-29684837 GGAAATACCCTGTGAGCACAAGG + Intergenic
904456478 1:30651280-30651302 AGGACCACCCTGTGTGCTATGGG + Intergenic
904953346 1:34262281-34262303 AGGAGCATCCAGTGAGCTCTGGG + Intergenic
905669424 1:39781701-39781723 GAGACCACACTGGGAGCTCTGGG + Intronic
907310963 1:53538775-53538797 AGGAACACACTGACAGCTCTGGG + Intronic
907797175 1:57729331-57729353 TGTGACACCCTGTGAGCTCAGGG - Intronic
908440545 1:64149575-64149597 GGGCACACCCTGTGAGATGTGGG - Intronic
908890681 1:68844148-68844170 GGGAACACCATGTGAAATATAGG + Intergenic
912842799 1:113053517-113053539 GGGAGCATCCTGTGAGCCCGGGG + Intergenic
915490115 1:156246071-156246093 GGGTACCCCCTCTGAGCTCAAGG + Exonic
920094983 1:203480760-203480782 GGGAACCTCCTGTTGGCTCTGGG + Intronic
920923426 1:210318533-210318555 GGGAAACCCTTGTGTGCTCTTGG - Intergenic
922902442 1:229147443-229147465 GGGAAGACCCTGTGAGGACACGG - Intergenic
923873988 1:238028013-238028035 GGGCCCAAGCTGTGAGCTCTAGG + Intergenic
924792563 1:247266352-247266374 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1064261088 10:13787216-13787238 TGGAAAACCCCGTGAGCTCCGGG + Intronic
1069785104 10:70982832-70982854 GGGAATTCCCTGTGGGTTCTAGG - Intergenic
1071569440 10:86688679-86688701 AGGAAATCCCTGTTAGCTCTTGG - Intronic
1072607762 10:96998784-96998806 GGGAGCACCATGTGAGCTTAAGG - Exonic
1080745593 11:35105859-35105881 GGCAACACCCTGTGAGGTTTGGG + Intergenic
1083934220 11:65862035-65862057 GGGAGCACCTGGTGAGCACTGGG + Exonic
1084312461 11:68324975-68324997 GAGACCACCAGGTGAGCTCTGGG + Intronic
1084614618 11:70227242-70227264 GGAAACACACTGTGTGCCCTCGG - Intergenic
1084645190 11:70452726-70452748 GGGAACTCCCTGTGGGTTCTGGG + Intergenic
1087175514 11:95091527-95091549 GGGAACACCCTGTGAGCTCTAGG - Intronic
1089180780 11:116581455-116581477 GGGAAAACCCTGAGAGATTTAGG - Intergenic
1089319722 11:117617222-117617244 GGGGACACCTTCTGAGCTCCTGG + Intronic
1089332482 11:117699613-117699635 GGGAGCAACCTGAGAGCTCCGGG - Intronic
1090373289 11:126271647-126271669 GGGACCACACGGTGAGGTCTGGG + Exonic
1090936402 11:131346776-131346798 TGGAACTCCCTGTGAGTTTTAGG - Intergenic
1090999184 11:131894148-131894170 GGAAATACTCTGTGAGCACTGGG + Intronic
1091290094 11:134434731-134434753 GGGACCACCCTGGGAACCCTGGG - Intergenic
1091328690 11:134713322-134713344 GGCAGCACCCTGGGAGCTCCCGG + Intergenic
1091668371 12:2435441-2435463 GGGCCCACCCTGAGAGCACTGGG - Intronic
1095945345 12:47750445-47750467 GGGAGCACACTGTGAACTGTGGG + Intronic
1095971391 12:47904244-47904266 GGGAACAGCCTGTGGTCTCCAGG - Intronic
1101561225 12:105859995-105860017 GGGAACACCTTCTGAACTCCGGG + Intergenic
1103961434 12:124611461-124611483 GGGAACACCCAGTGGGCACCAGG - Intergenic
1104420042 12:128627668-128627690 GGAAAGCCCCTGTGAGCCCTGGG + Intronic
1104914970 12:132259954-132259976 GGGAACACCCTGTGCATTGTGGG + Intronic
1106915684 13:34511481-34511503 GGGGCTAGCCTGTGAGCTCTAGG - Intergenic
1113408002 13:110059702-110059724 AGGAACAGACTGTGAGCTCCAGG - Intergenic
1115501427 14:34053361-34053383 GGGAACAGGATGTGAGCACTGGG + Intronic
1115723868 14:36191997-36192019 GGAAATATCATGTGAGCTCTGGG + Intergenic
1116777750 14:49201365-49201387 GGGGATACCCGGAGAGCTCTTGG - Intergenic
1119992492 14:79214979-79215001 AGGGACACACTGTGAGCTCAAGG + Intronic
1121951200 14:98172340-98172362 AGAATCACCCTGTGTGCTCTGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122458946 14:101879510-101879532 GGGAACAGCCTGTGACATCAGGG - Intronic
1122969255 14:105145844-105145866 GCGACCACCCTGTGAGGCCTGGG - Exonic
1123778774 15:23605304-23605326 AGGAACACCCTGTGACTTATAGG + Intronic
1125488442 15:40128482-40128504 GTGTACACCCCCTGAGCTCTTGG - Intergenic
1125973357 15:43930155-43930177 GGGAACCCCTGCTGAGCTCTTGG + Intronic
1126119959 15:45242618-45242640 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
1126426457 15:48531732-48531754 GGAAGTACCCTGAGAGCTCTTGG - Intronic
1128939520 15:71777074-71777096 GAGAAAAACCTGTGAGCCCTTGG + Intronic
1129365197 15:75049779-75049801 GGCAACACCCCCTGATCTCTGGG - Exonic
1130537647 15:84798583-84798605 GGGAACACCGTGGGTGCTCTGGG - Exonic
1131793468 15:95989643-95989665 CAGAAGACACTGTGAGCTCTAGG - Intergenic
1133678248 16:8096229-8096251 GGGAAGACCCAGTGAGCACCTGG - Intergenic
1133945522 16:10344703-10344725 GGGAACACCCTGTTCTGTCTAGG - Intronic
1134228419 16:12410325-12410347 GACAACACCCTGTGGCCTCTAGG - Intronic
1134290159 16:12898308-12898330 TGGAACACCTGGTGAGCTCATGG - Intergenic
1135388860 16:22071209-22071231 GGGCTCTCCCTGTCAGCTCTAGG - Intronic
1135522013 16:23184841-23184863 GGGACCACCCTGTATGCCCTAGG + Intronic
1136919520 16:34252220-34252242 GGGGACACTTTGTGAGCTTTTGG + Intergenic
1137440294 16:48492962-48492984 AGGAACATGCTGTGACCTCTGGG - Intergenic
1140944696 16:79757077-79757099 GGGAAGATCCTGTGATCTCTTGG + Intergenic
1142043128 16:87908157-87908179 GGGAACCGCCTGGGATCTCTAGG + Intronic
1142232047 16:88904616-88904638 AGGAACACCCTGGGAGCTGGTGG + Intronic
1142322624 16:89394042-89394064 AGGAGCACCCTGTGAGCTGCAGG - Intronic
1144740134 17:17577112-17577134 GGGAACACACTGGGAGGCCTGGG + Intronic
1145007339 17:19345039-19345061 GGGAGCTCCATGTGAGCTCCGGG - Intronic
1146775143 17:35607600-35607622 GAGAAGGCCCTCTGAGCTCTTGG - Intronic
1152027614 17:77822004-77822026 GGGAAGATTCTGTGAGCTTTTGG + Intergenic
1152554763 17:81047267-81047289 GGGGCCAGCCTGTCAGCTCTTGG - Intronic
1152861042 17:82697419-82697441 GGGAAGGACCTGTCAGCTCTGGG - Intronic
1153259549 18:3209987-3210009 GGGAACACCCAGTGAGGTTTAGG - Intronic
1160373320 18:78391839-78391861 GGGAAAAGGCTGTGAGCACTGGG + Intergenic
1160489735 18:79326586-79326608 CCGAACACCATGTGAGCTCAGGG - Intronic
1161280095 19:3441371-3441393 GGCAACACTCTGTGAGATCAGGG + Intronic
1162424064 19:10583487-10583509 GGGAAGACCCAGGGAGATCTGGG + Intronic
1166544476 19:43625899-43625921 GGGAACCCCAGGTGAGCTCTGGG - Exonic
1167456697 19:49599928-49599950 TGGCACTCCCGGTGAGCTCTGGG + Exonic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
925412887 2:3650214-3650236 GGGAACACTCTCTGGGTTCTGGG + Intergenic
926302878 2:11617060-11617082 GGGAAAACCCTGTGCCCTGTGGG + Intronic
927684796 2:25162864-25162886 GAGATCCCCCAGTGAGCTCTGGG + Intronic
928442654 2:31304984-31305006 TGGGACTCCCTGTGATCTCTGGG - Intergenic
930744869 2:54871875-54871897 CAGAACACAGTGTGAGCTCTGGG - Intronic
931246737 2:60498429-60498451 GGGCACACCCTGTGATCTTGTGG - Intronic
934739301 2:96707631-96707653 GAGACCGCCCTGTGAGCTATGGG + Intronic
939920349 2:148102851-148102873 GTGAACAGACTGTGAGCTCCTGG - Intronic
943650882 2:190456514-190456536 GGGAACTCCCTGGCTGCTCTAGG + Intronic
947468869 2:230381886-230381908 TCGAACACCTTGTGTGCTCTGGG - Intronic
947791394 2:232871284-232871306 GGCCACACCCTGGGAGGTCTGGG + Intronic
948670319 2:239564340-239564362 GGTGACACCCTCTGAGATCTTGG - Intergenic
1168795400 20:607646-607668 GGGAGGCCCCTGTGAGCTGTGGG + Intronic
1174203589 20:48824067-48824089 GGGTACTCCCCGTGTGCTCTGGG - Intronic
1176040012 20:63060403-63060425 TGACTCACCCTGTGAGCTCTGGG - Intergenic
1176108994 20:63402695-63402717 GGGGGCACCCTTTGAGCTGTGGG - Intergenic
1177841273 21:26236506-26236528 GGGAGCACCCTCTTTGCTCTGGG - Intergenic
1180739462 22:18042452-18042474 GGGAACACCATGTGATGACTAGG + Intergenic
1181595058 22:23908711-23908733 GGGAACCCCCAGTGAACTCTCGG - Intergenic
1183219749 22:36504974-36504996 GGGAAAATACTGTGAGCTCAGGG - Intronic
1183339887 22:37274240-37274262 GGGACCAGCCTGTGAGATCCTGG - Intergenic
1183672410 22:39280621-39280643 GGGGACACCTTGTGTTCTCTGGG - Intergenic
1183744410 22:39684840-39684862 GAGGACACCCTGGGTGCTCTGGG + Intronic
1185276792 22:49953403-49953425 CTGAACACCCTGTCCGCTCTTGG - Intergenic
1185373639 22:50472100-50472122 GGGATCACCTTCTGTGCTCTGGG - Intronic
949513696 3:4788459-4788481 TGAACCACCCTGTGAGCTCAAGG - Intronic
950483895 3:13261458-13261480 GGGGATACACTGGGAGCTCTCGG - Intergenic
952827700 3:37537909-37537931 GGGAACAGCCTGTGGCCCCTTGG + Intronic
954153052 3:48668257-48668279 GGGAGGATCATGTGAGCTCTGGG + Intergenic
954293945 3:49663919-49663941 GAGAACAGCCTGGGTGCTCTGGG - Intronic
954318048 3:49811954-49811976 GTGAACTTCCTGGGAGCTCTGGG + Exonic
961087669 3:124083047-124083069 GGAGAAACTCTGTGAGCTCTTGG + Intronic
961171604 3:124801457-124801479 GTGACAACCCTGTGTGCTCTGGG - Intronic
964269875 3:154944463-154944485 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
966008862 3:175051493-175051515 GGGGACTACCTGTGACCTCTAGG - Intronic
969702763 4:8776788-8776810 GGGGGCACCCAGTGAGCACTCGG - Intergenic
970152128 4:13101119-13101141 GGGAACACCAGGAGGGCTCTAGG - Intergenic
971557230 4:28029013-28029035 GGGACCACACTCTGAGCTTTAGG + Intergenic
977354090 4:95923972-95923994 GGAAACTACCTGTGAGCTTTTGG + Intergenic
977730122 4:100341138-100341160 GCCAACATCATGTGAGCTCTTGG - Intergenic
978898204 4:113916066-113916088 GGAAACACCCTGTGAGACATTGG - Intronic
982313640 4:154010175-154010197 GTGAAGACCCTGTAAGCCCTGGG + Intergenic
985544726 5:503915-503937 GGGAACCCCCCAAGAGCTCTGGG - Intronic
985820573 5:2157399-2157421 GGGGAAGCCCTGTGAGCCCTTGG + Intergenic
988497568 5:31758102-31758124 TGAAAAACCCTGGGAGCTCTTGG - Intronic
995973089 5:117997062-117997084 GTGAGCATCCTGTGAGGTCTGGG - Intergenic
999144402 5:149382832-149382854 ACGAGCACCCTGGGAGCTCTCGG - Intronic
1001457163 5:171872686-171872708 GGGAAAACCGTGTGTGCCCTGGG - Intronic
1002315469 5:178340626-178340648 GGGTATTCCCTGTGTGCTCTGGG - Intronic
1012972279 6:105743994-105744016 GGGGGCATCCTGTGATCTCTAGG + Intergenic
1014269124 6:119316086-119316108 GGGAAAGCCCTGTAAGATCTTGG - Intronic
1018779901 6:167053759-167053781 TGAAACACCCTGAGAGCCCTGGG - Intergenic
1019530460 7:1500451-1500473 GGGCCGACCCTGAGAGCTCTGGG - Intronic
1019578262 7:1748049-1748071 GGGGACACGCTGTGCTCTCTTGG + Intergenic
1019730495 7:2627070-2627092 GGAAAGACCCTGGGAGCTCCTGG + Intergenic
1023711911 7:43003842-43003864 TGGAAAACCCTGTGTGCTCCAGG - Intergenic
1024930515 7:54663446-54663468 TGGAAAACCCTGGGAGCTCAGGG - Intergenic
1034646572 7:152652977-152652999 GTGAGCACCCTGTGGTCTCTGGG - Intronic
1039434157 8:37548226-37548248 GGGAACACCCTCTGTGCTCTGGG - Intergenic
1041727765 8:61033641-61033663 TGGAACAGCCTGGGAGCTTTTGG + Intergenic
1043295318 8:78654522-78654544 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1049877229 8:145032565-145032587 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1050627063 9:7516245-7516267 GGGAACACAATGTCCGCTCTTGG + Intergenic
1051700449 9:19817124-19817146 TGGAAGACACTGTGAGTTCTCGG + Intergenic
1056933152 9:90895386-90895408 GGGACCACGCTGTGAGCTGCAGG + Intronic
1058520345 9:105809749-105809771 GGGAACACCCTTTGAGATATTGG - Intergenic
1061057835 9:128233651-128233673 GGGAACACCTTGGGAGCTAACGG + Intronic
1061232123 9:129321181-129321203 GGGAAGGCCCTGGGAGCCCTTGG + Intergenic
1061311968 9:129769473-129769495 GGGAACTCCCTGTGAGCCATGGG + Intergenic
1061402181 9:130374428-130374450 GGGAGCAGCCTGTGACCCCTGGG + Intronic
1061569778 9:131470080-131470102 GGGAACACACTGGGACCCCTAGG - Intronic
1186759141 X:12704963-12704985 GGGAACATCCTGTGTATTCTGGG + Intronic
1192439245 X:71162798-71162820 GAGAACTCCCCATGAGCTCTGGG + Intronic
1194767280 X:97856333-97856355 GGGAAGATCCCTTGAGCTCTGGG - Intergenic
1197252238 X:124228255-124228277 GGGAACAAGCTGTGTGTTCTGGG + Intronic
1197727123 X:129783728-129783750 CTGAGCACCCTGTGAGCTCTAGG - Intronic
1200851935 Y:7892194-7892216 GTGAACACCCTGCTAGATCTAGG + Intergenic