ID: 1087177154

View in Genome Browser
Species Human (GRCh38)
Location 11:95106409-95106431
Sequence TTCTGGTTGAATATAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087177145_1087177154 15 Left 1087177145 11:95106371-95106393 CCATGTAACTGACATGGATGAGT 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1087177154 11:95106409-95106431 TTCTGGTTGAATATAAAGGAAGG 0: 1
1: 0
2: 2
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087177154 Original CRISPR TTCTGGTTGAATATAAAGGA AGG Intronic
903874837 1:26466722-26466744 TTCTGGCAGAACAGAAAGGATGG - Intronic
905343386 1:37294670-37294692 TTCAGGTTGAATAGAAATAAGGG - Intergenic
906055220 1:42910709-42910731 CTCTGGTTTAATGTAGAGGAAGG - Intergenic
908736216 1:67279557-67279579 TTCTGGTTTAATATAAATTAAGG + Intergenic
909175753 1:72356405-72356427 TTCTGGTAGTATAAAAAGGTGGG - Intergenic
909283042 1:73781413-73781435 TTCAGTTTGAGTCTAAAGGAAGG - Intergenic
911949181 1:104150938-104150960 TTCTGGAATAATATAATGGAAGG + Intergenic
912651127 1:111440620-111440642 TTCTGGCTGAATAAAAAGTTTGG - Exonic
912733594 1:112130868-112130890 CTTTGGTTTAATATAAAGTAAGG - Intergenic
914894404 1:151655720-151655742 TTCTGGTTGTATTTAATGGGAGG + Intronic
916711123 1:167410193-167410215 TTATTGTTAAATAAAAAGGAAGG - Intronic
917823618 1:178792863-178792885 TAGTGGTTGAATATAGATGATGG - Intronic
921060579 1:211580646-211580668 TTTTGCTGGAATATAAAGAATGG + Intergenic
922341578 1:224660686-224660708 TTCTGGCTTAATATAAATTAAGG - Intronic
922986148 1:229867378-229867400 TTCAGATTGAATCTAAATGAGGG - Intergenic
924013011 1:239686544-239686566 TTCTGCGTAAATATGAAGGAAGG - Intronic
924362810 1:243259019-243259041 TCCTGGCTGAATATCAATGAAGG - Intronic
1064912607 10:20419173-20419195 TTTTGGTTGAATATTTTGGAAGG - Intergenic
1065155276 10:22863197-22863219 TTCTTTTTTAATTTAAAGGAAGG - Intergenic
1068519128 10:58060089-58060111 TTTTAGGTGAATTTAAAGGAAGG - Intergenic
1070044567 10:72819482-72819504 TTCTTATTAAATATAAAGCAAGG + Intronic
1071350970 10:84744202-84744224 TTCTGGTTCAATAAACAGAAAGG - Intergenic
1072268130 10:93750029-93750051 TTCTGCTTGAGTTTAAAGGCAGG + Intergenic
1073445414 10:103577411-103577433 TCCTCTTTGTATATAAAGGAAGG + Intronic
1074376112 10:112941960-112941982 TTCAGTTTGAAAATAAATGATGG - Intergenic
1074978878 10:118603138-118603160 TTCTAGTTGATAATGAAGGAGGG - Intergenic
1074979099 10:118605046-118605068 TTCTGGTTGTTAATGAAGGAGGG - Intergenic
1074989944 10:118696118-118696140 TTATGTTTGAATATATATGATGG + Intronic
1076708257 10:132314143-132314165 TTCTGCATCTATATAAAGGAGGG + Intronic
1078301868 11:10139684-10139706 TTTTTGTTCAATAAAAAGGATGG + Intronic
1078639709 11:13083199-13083221 TTCTGGTAGAATAGAAAGCGAGG + Intergenic
1080235220 11:30060358-30060380 TTCTGATTAAATATCCAGGATGG - Intergenic
1080659400 11:34283947-34283969 TTCTTGGTAAATCTAAAGGAGGG + Intronic
1081072522 11:38629048-38629070 TCTTGGTTTAATATAAAGGAAGG + Intergenic
1084532516 11:69736451-69736473 TTCTGGTTTAATATAAATTAAGG - Intergenic
1086411959 11:86552533-86552555 TTCTGGTTAAATTGACAGGATGG - Intronic
1087177154 11:95106409-95106431 TTCTGGTTGAATATAAAGGAAGG + Intronic
1088395489 11:109363435-109363457 TTCTGGTCCAATAGTAAGGATGG - Intergenic
1088790221 11:113218550-113218572 TTCTTGTTCATTATAAAAGAAGG + Intronic
1089054368 11:115573300-115573322 TTCTGGATGAATGAAAAGTATGG - Intergenic
1089111159 11:116057962-116057984 GACAGGTTGAAAATAAAGGATGG - Intergenic
1090561782 11:127940439-127940461 TTCTGGTTTAATATAAATTAAGG - Intergenic
1091150446 11:133323730-133323752 TTCTGGGAGAAAACAAAGGAGGG + Intronic
1093752411 12:22815786-22815808 TTCTGCTTGCATTCAAAGGATGG + Intergenic
1094723027 12:33084633-33084655 TTCTGGTAGCATCTAAAGGTAGG - Intergenic
1094770315 12:33650455-33650477 CTCTGGTTGAAGATATAGAAAGG + Intergenic
1097070895 12:56354215-56354237 TTCTGGGTGATTAAAAAAGAAGG + Intronic
1098825648 12:75294277-75294299 TGCCTGTTGAATATAAAGGAAGG + Intronic
1099188316 12:79539701-79539723 TTTTGGTTGAATCCATAGGAAGG - Intergenic
1100572221 12:95853476-95853498 TTTTGATTGAATATAAATGTAGG + Intergenic
1100750960 12:97697821-97697843 TTTTGCTTGATTATAAAGCAGGG + Intergenic
1102829317 12:115981879-115981901 TGGTGGTTGAATGTAAAAGACGG + Intronic
1102943838 12:116967693-116967715 TTCTGGTTGAAAAGAAAGCTTGG + Intronic
1102963344 12:117107929-117107951 TGCTGTTTGAAGATGAAGGAAGG + Intergenic
1103156578 12:118690138-118690160 TTATGTTTCAATAAAAAGGAAGG - Intergenic
1104336873 12:127905983-127906005 TTTATTTTGAATATAAAGGAAGG + Intergenic
1104397722 12:128448727-128448749 TTATGGTAGATTATAAAAGAGGG - Intronic
1107780364 13:43895211-43895233 TTCTTGTGGAATAAAAAGGGAGG + Intergenic
1109073207 13:57796309-57796331 TTATGGATGAAAACAAAGGATGG - Intergenic
1110465362 13:75793974-75793996 TTGTGGTTGAATATAGTTGAAGG + Intronic
1110512607 13:76369039-76369061 TTCTGATCTAATATACAGGAGGG + Intergenic
1112192198 13:97188850-97188872 TCTTGGCTGAAAATAAAGGAAGG - Intergenic
1112955919 13:105058176-105058198 TTCTGGTCTAATATAGAGTATGG - Intergenic
1113609380 13:111632499-111632521 GTCTGGGTGAAGATAAAGGACGG + Intronic
1114534315 14:23413213-23413235 TACTGGTTGTATATAAATTAGGG + Intronic
1114990446 14:28280295-28280317 TTGTCCTTGAATGTAAAGGAGGG - Intergenic
1116705433 14:48291530-48291552 TTGTGGTTGGATGGAAAGGAGGG + Intergenic
1116873635 14:50090810-50090832 TTGTGGTTGAAGATAAACGGAGG - Intronic
1120117033 14:80631510-80631532 TTATCTTTGAATATAAAGAATGG - Intronic
1120304355 14:82748998-82749020 TTCTGCTTGAATCTAATTGATGG + Intergenic
1120597384 14:86457866-86457888 ATGTGGTTGAAGATAAATGATGG + Intergenic
1120957645 14:90097111-90097133 TTCTGGGTGTATAGGAAGGAGGG - Intronic
1124362992 15:29052706-29052728 GACTGGTTGATTATAAAGAATGG + Intronic
1128920267 15:71603817-71603839 TTCTGGCAGTATATAAAGGGTGG + Intronic
1128992229 15:72270704-72270726 TTCTGTTTTAATAAATAGGATGG - Intronic
1129931871 15:79418104-79418126 TTCTCCTTGGAGATAAAGGATGG + Intronic
1131008363 15:88997039-88997061 GTCTGGGTTAAGATAAAGGATGG - Intergenic
1133081702 16:3326484-3326506 TTCTAGTTGAATAGAACAGAGGG - Intergenic
1134036224 16:11033277-11033299 TTCTGGTTGATTTGAAAGGAGGG + Intronic
1135005262 16:18815568-18815590 TTTTGGGTGAATATAAATCATGG - Exonic
1135939489 16:26809200-26809222 TTCTCTCTGAAAATAAAGGATGG + Intergenic
1137362285 16:47829644-47829666 TTCTTGTTGAGAATAAAAGAAGG + Intergenic
1140276865 16:73517185-73517207 TTCTGGTTGAAGGTGATGGACGG - Intergenic
1141963830 16:87427583-87427605 GTCTGGGTGACTTTAAAGGATGG + Intronic
1142878230 17:2865304-2865326 TTCTGGTTGTTTTTAAAGGAAGG + Intronic
1146098843 17:29959383-29959405 TTCTGCTTGAAGAAAAAAGAGGG - Intronic
1146836231 17:36113109-36113131 TCCTGGTTTAATGTAGAGGAAGG + Intergenic
1148561157 17:48607258-48607280 TTCTGTGTGTATCTAAAGGATGG - Exonic
1149817380 17:59739351-59739373 TTCTTGTTGAATGTAATTGATGG + Intronic
1149971070 17:61219038-61219060 TTCTGTTTGCTGATAAAGGATGG + Intronic
1150186136 17:63183414-63183436 TTCTAGTTTAATATAAATAAAGG + Intronic
1150756836 17:67922250-67922272 TTGTGATTGAATATATGGGAAGG + Intronic
1150832067 17:68531568-68531590 TTCTAGCTGAATAAAAAGGAAGG - Exonic
1153447355 18:5188684-5188706 TTATGGTAGAATTTACAGGAGGG - Intronic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1155735332 18:29215600-29215622 TTCCTTTTGTATATAAAGGAAGG - Intergenic
1155924038 18:31634664-31634686 TTCTAGTTAAATATAGAGGATGG - Intronic
1155975817 18:32129310-32129332 TTTTGATTGAAAATAAAGGTAGG + Exonic
1156223509 18:35078759-35078781 TTCAAGTAGAATGTAAAGGATGG - Intronic
1157048009 18:44125798-44125820 TTGTGGTTGAATTTAGGGGAGGG - Intergenic
1158256728 18:55558999-55559021 TTCTGGATAAATAAAAAGTATGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158388123 18:57018129-57018151 TTCTGGTTGCTGATTAAGGAAGG + Intronic
1162492883 19:11004612-11004634 TTCAGGTTGAAAGTAAAAGAAGG - Intronic
1166128478 19:40731120-40731142 TACTGGTTTAATATAAAGCAGGG + Intronic
926379324 2:12269146-12269168 TCCTGGTAAAATAAAAAGGAGGG - Intergenic
927421856 2:22942262-22942284 TGTTGGTTGAATATTAAGCAAGG - Intergenic
930051748 2:47221548-47221570 CTCTGGTTGATTATATAGGTAGG - Intergenic
931070323 2:58640299-58640321 TGCAGCTTGAATATGAAGGAAGG - Intergenic
934887142 2:98034807-98034829 TTATGGTAGAATTTACAGGAGGG + Intergenic
935406139 2:102711554-102711576 TGCTGGTGGATTCTAAAGGAAGG - Intergenic
939086243 2:137721638-137721660 TCTTGGTTTAATGTAAAGGAAGG + Intergenic
939710414 2:145509933-145509955 TGCTGCTGGAATATAAGGGAAGG + Intergenic
941264249 2:163340104-163340126 ATCTGGTTGAATAAAATGTACGG + Intergenic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
943239475 2:185364660-185364682 CTTTGGTTTAATATAGAGGAAGG - Intergenic
943434157 2:187843060-187843082 TGCTGGTTTAATATAAGTGAAGG + Intergenic
943587074 2:189753665-189753687 TTCTTGTTGGATTTAAAAGAGGG - Intronic
944754895 2:202750869-202750891 TTTTGGTTGAATAAACATGAAGG + Intronic
945923142 2:215776897-215776919 TTCTGCTTGAAAAGAAAGGTGGG - Intergenic
945983015 2:216329566-216329588 TACTGGATTAATATAAAAGAAGG + Intronic
946956462 2:224935356-224935378 TTCTGGAGGAATATGAAGGTTGG - Intronic
948166703 2:235868350-235868372 ATCTGACTGAATGTAAAGGACGG - Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1170684100 20:18553562-18553584 TTGTGGATGAGTATAAAAGAAGG + Intronic
1170870786 20:20204234-20204256 TTCTGGTTGCTTATTAATGATGG + Intronic
1170906987 20:20525106-20525128 TTCTGGTTGAAAAATTAGGAGGG + Intronic
1173050915 20:39560900-39560922 TTCTGGTGGAATATGGAGGATGG + Intergenic
1178239474 21:30882205-30882227 TGTTGGTTGAACATAAAGGGTGG - Intergenic
1178876112 21:36415404-36415426 TACTGGTTTAATATAATGAAAGG + Intronic
1182388755 22:29971685-29971707 TTCTGGTTAAAGATACAGGAGGG - Intronic
949704211 3:6797343-6797365 TTCAGATTGGATGTAAAGGAGGG + Intronic
950202577 3:11055507-11055529 TTCTGTTTGAACAGAAGGGAGGG + Intergenic
952393238 3:32898820-32898842 TTTTTGTTGAATATAAAAGTTGG + Intergenic
953475766 3:43204706-43204728 TTCTGGTTGGATGGAAAGCATGG + Intergenic
953920707 3:46949428-46949450 GTCTGGCTGCATATGAAGGAAGG - Intronic
954398039 3:50303339-50303361 TTCTGGTGGAAGAGACAGGAAGG - Exonic
954961697 3:54571188-54571210 GTCTGGGTTAAGATAAAGGATGG + Intronic
955719654 3:61867453-61867475 TTATTGTTAAATAAAAAGGAGGG - Intronic
955734074 3:62018079-62018101 TTCTCAATGAATACAAAGGAAGG - Intronic
957771958 3:84706185-84706207 GAGTTGTTGAATATAAAGGAAGG - Intergenic
958018586 3:87970337-87970359 TTCTGATTCAGTATCAAGGATGG + Intergenic
959148226 3:102575378-102575400 TGCTAGTTTAATATAAAGCATGG + Intergenic
961050823 3:123745402-123745424 TTCTGGTTGAATATTAAACTTGG + Intronic
963602064 3:147387481-147387503 TTGTGGTTGAATAAAAAGGATGG - Exonic
965168042 3:165222091-165222113 TTATTGATGAATATAAATGATGG - Intergenic
966275416 3:178159918-178159940 TTCCTGTCTAATATAAAGGAAGG + Intergenic
966677067 3:182601162-182601184 TTCTCTTTGAATAGAAATGAAGG - Intergenic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
967672228 3:192250800-192250822 TTCTGGTAGACTAGAAAGGAAGG + Intronic
969329677 4:6466865-6466887 TTCGGGTTGATTAAAAAGAAAGG + Intronic
971245092 4:24920228-24920250 TCCTGGGTGAATGTAAATGATGG + Intronic
972029886 4:34441397-34441419 TTTTGATTGATTATAAAGGCAGG - Intergenic
972317076 4:37936700-37936722 TTCTGGAGAAAGATAAAGGAAGG + Intronic
972659873 4:41105909-41105931 TTCTGGTTGATTATAATAGTTGG - Intronic
973120508 4:46515920-46515942 TCCTGGTTGAAAAAAAAGGTGGG + Intergenic
973143238 4:46794402-46794424 CTTTGGTTTAATATATAGGAAGG + Intronic
974583691 4:63840623-63840645 TTCTACTTGTATATAAAGAAGGG - Intergenic
975024223 4:69529554-69529576 CCCTGGTTTAATATAGAGGAAGG + Intergenic
975802180 4:78072170-78072192 TTCTGCTCTAATATAAATGATGG - Intronic
977169148 4:93738991-93739013 TTCAGCTTGAAGATATAGGATGG + Intronic
977761030 4:100737253-100737275 TTCTGGTAGAAAATCAAGAAAGG - Intronic
978784896 4:112598507-112598529 GCCTGGAAGAATATAAAGGAGGG + Intronic
979102352 4:116635414-116635436 TTATGTTTAAATATAAAGTAAGG - Intergenic
980525413 4:133985354-133985376 ATCTGATTGAATATGAAGCAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
989540055 5:42607593-42607615 TTATGGTGGTATATAAATGATGG + Intronic
990409735 5:55530011-55530033 TTTTGATTGAAAATAAAGGTAGG - Intronic
990905275 5:60796231-60796253 TTCTGCTAAAGTATAAAGGATGG - Intronic
991112571 5:62917680-62917702 TTCCTGTTGAACATACAGGATGG + Intergenic
992657904 5:78928825-78928847 TTTTGCTTGAATATATAGAAGGG - Intronic
993245441 5:85445789-85445811 TTCTGGTTTAATTTGAAGAATGG + Intergenic
994045150 5:95300083-95300105 TTTTGTTTGAAAATAAATGATGG + Intergenic
995800538 5:115989111-115989133 TTCTGGTTTCATATAAAGGATGG - Intronic
996297596 5:121940895-121940917 TTCTTGTTTAATATCATGGATGG + Intergenic
996653596 5:125913280-125913302 TTCTGCTTGAATAAAAAATAGGG - Intergenic
998721172 5:144951424-144951446 ATCTGGTTTAAAATGAAGGATGG + Intergenic
999394390 5:151217827-151217849 TTCTGGGTGAATGTAAATGTAGG + Intronic
999574935 5:152965512-152965534 GGTTGGTTGAATATGAAGGAGGG - Intergenic
999750381 5:154624129-154624151 TCCTGGTTGGATCAAAAGGAAGG + Intergenic
1000897398 5:166872285-166872307 TTCAAGTTGAATATATAGGGTGG + Intergenic
1002313473 5:178328576-178328598 TTATGGCTGAGTATAAAGTAAGG + Intronic
1002545281 5:179938707-179938729 TTCTGGTTTAATATAAATTAAGG - Intronic
1004577653 6:16913119-16913141 TTCTTGTTGAAAATAATGCAAGG + Intergenic
1004639795 6:17504103-17504125 TTGTGTTTGCATATAAGGGATGG + Intronic
1004967605 6:20872715-20872737 TTCAGTTGTAATATAAAGGATGG + Intronic
1005075485 6:21902603-21902625 TTCTAGATGAAAAGAAAGGAGGG + Intergenic
1005267926 6:24132596-24132618 CACTGTTTGAATATAAATGAAGG - Intronic
1007049460 6:38812154-38812176 CTCTGGTGGAATATAGAGGATGG - Intronic
1008706531 6:54167197-54167219 TTCTGGTTTTAAATAGAGGAGGG - Intronic
1009271301 6:61618350-61618372 TTTAGATTGATTATAAAGGATGG + Intergenic
1009743023 6:67772663-67772685 TTATGATTGAATAAAAAGAATGG - Intergenic
1010521516 6:76843909-76843931 TTCTAGATGAAAAGAAAGGAAGG + Intergenic
1011562476 6:88635080-88635102 TTCTGAGTGAATAAAAAGAATGG - Intronic
1011911247 6:92442327-92442349 TTGTGTTTGAATATGAATGACGG + Intergenic
1012515703 6:100056532-100056554 TTGTGGTTGAATATAAACTTAGG + Intergenic
1012713030 6:102632497-102632519 TTCTAGTGGAATAGAAAGCATGG + Intergenic
1013063789 6:106662856-106662878 TTCTGGCTGAATAAAAAGTTTGG - Intronic
1013469616 6:110450171-110450193 TACTGGTTAAAAAAAAAGGAGGG + Intronic
1013867459 6:114715847-114715869 TTCTTGTTGGATATAAACTAGGG + Intergenic
1014255831 6:119159468-119159490 TTCTGCTTGTATGTAAAGGAAGG - Intergenic
1018236544 6:161731183-161731205 TTCTTGTTGAGTTTAAAAGATGG + Intronic
1020081328 7:5287483-5287505 CTCTGGATGGATAGAAAGGACGG + Intronic
1022149316 7:27584133-27584155 TTTGGGTTTAATATAAAAGAAGG - Intronic
1022289464 7:28987067-28987089 CACTGGGTGAATATAAAAGAAGG + Intergenic
1022541973 7:31146069-31146091 TTCTGCTTGAATAAAACAGAGGG - Intergenic
1023296662 7:38721899-38721921 TTCTGGGTAAATGTAAAGAAAGG + Intergenic
1023557368 7:41437296-41437318 TGCTGGTCCAATATAATGGAAGG - Intergenic
1024053284 7:45643505-45643527 GTCTGGTAGAATATAATGCAAGG - Intronic
1024756424 7:52538547-52538569 TTCTGTTTGAATCTAATGGCAGG - Intergenic
1024765182 7:52649464-52649486 TTCTTGTTGGAGGTAAAGGAGGG + Intergenic
1024765291 7:52650455-52650477 TACTGGTTGAAAGTAAAGCAGGG - Intergenic
1025168802 7:56737250-56737272 TTGTTTTTTAATATAAAGGAGGG - Intergenic
1025703589 7:63842662-63842684 TTGTTTTTTAATATAAAGGAGGG + Intergenic
1027900274 7:84104851-84104873 TTAAGTTTGAATATAAATGATGG + Intronic
1028478615 7:91279444-91279466 TTTTAGAAGAATATAAAGGATGG - Intergenic
1028690821 7:93647558-93647580 TGCTGGTGGAATATAAAACAGGG + Intronic
1028963847 7:96779827-96779849 TTCTAGTTGATTATAATAGAAGG + Intergenic
1031822823 7:126525851-126525873 TTCTGGTTCAAGATAATGGCTGG - Intronic
1034056188 7:148037326-148037348 TTCTGACTTAATATAATGGAAGG + Intronic
1035218111 7:157386115-157386137 TTCTGGTTTAATATAAATTAAGG + Intronic
1037701898 8:21283035-21283057 TTCTGGAAGAAAATAGAGGAGGG + Intergenic
1038411605 8:27363410-27363432 TTTGGGATGAATATAAAGGAAGG + Intronic
1038789219 8:30653303-30653325 ACTTTGTTGAATATAAAGGATGG - Intronic
1039089805 8:33815687-33815709 TTCTGAGTGAATGTTAAGGAGGG + Intergenic
1039375925 8:37033943-37033965 TAGTGTTTGAATATAAAGAAAGG - Intergenic
1040344545 8:46477030-46477052 ATCTTGTTGAATGTAAAGAAAGG + Intergenic
1040346948 8:46512605-46512627 AACTTGTTGAATATAAAGCAAGG - Intergenic
1040590382 8:48787473-48787495 TGCTGTATGAATATAAAGGGAGG - Intergenic
1042826922 8:72989089-72989111 TTCTGGCTGAAATTACAGGAAGG + Intergenic
1043630887 8:82331597-82331619 TTCTTGTTGACTATAAATAAGGG - Intergenic
1045663869 8:104466198-104466220 TTTTGGTTGGGGATAAAGGATGG + Intronic
1046353161 8:113042750-113042772 CTTTGGTTGCATATAAAAGAAGG + Intronic
1047591211 8:126329452-126329474 TTGTGGCAGAAAATAAAGGAAGG - Intergenic
1048655603 8:136532298-136532320 TTCTGGTTTACTATATAGGGTGG + Intergenic
1051235864 9:14998136-14998158 TTCTGGGGGAATGTGAAGGAAGG + Intergenic
1051310610 9:15766964-15766986 TACTGGTTATATTTAAAGGAGGG + Intronic
1051436936 9:17043274-17043296 TTCTGGGTCAATGTGAAGGATGG + Intergenic
1052400257 9:27991206-27991228 CTCTGGTTGAATACAATGAACGG + Intronic
1053463660 9:38289583-38289605 TTCTTGTTGAATGGAATGGATGG + Intergenic
1055132505 9:72792567-72792589 TTACAGTTGCATATAAAGGAAGG + Intronic
1057099765 9:92347153-92347175 TACTGGCTGAATAGAAGGGAAGG + Intronic
1058832720 9:108833315-108833337 TTCTGCGTGAATATGAAGGTGGG - Intergenic
1060643723 9:125260828-125260850 ATCTGGCTGAATGTACAGGAGGG + Intergenic
1187185130 X:16977289-16977311 TTCTGCCTGAGTATTAAGGATGG + Intronic
1190968446 X:55325308-55325330 GGCAGGTTGAAAATAAAGGATGG - Intergenic
1193027339 X:76858650-76858672 TCCTGGCTAAATATAAAAGAAGG + Intergenic
1194492792 X:94571651-94571673 TTATGGTAGAATTTACAGGAGGG - Intergenic
1195491801 X:105479199-105479221 TTCTTCTTGAATCTAAAGAAGGG - Intronic
1195583523 X:106535248-106535270 ATTTGGTTGAATACACAGGATGG - Intergenic
1195898969 X:109777796-109777818 TTCTTTTAGAATAGAAAGGATGG + Intergenic
1196843900 X:119883116-119883138 TTCTGGTTGAGGGTAAGGGATGG + Intergenic
1196976638 X:121164945-121164967 TTTTGGCTGATTATAAGGGAGGG + Intergenic
1197612383 X:128653813-128653835 CTCTGTTTAAATATCAAGGAAGG + Intergenic
1197831913 X:130651961-130651983 TTGTTGTTCAATAAAAAGGAAGG - Intronic
1198663262 X:138994691-138994713 CTCTGATTAAATATAAAGCATGG - Intronic
1198832674 X:140767031-140767053 TTCTGGTTAAATAAAAAAGAAGG - Intergenic
1199361795 X:146928914-146928936 TAATGGTTGAATATAAAGCAGGG - Intergenic
1200204625 X:154306993-154307015 TTCTGGTTTAAAATAAGGAAAGG + Intronic
1200280082 X:154769869-154769891 TTCTGGGTGAATGTAAAGGGAGG + Intronic
1200299726 X:154961084-154961106 ATCTCCTTGAATACAAAGGACGG + Exonic