ID: 1087177878

View in Genome Browser
Species Human (GRCh38)
Location 11:95111661-95111683
Sequence CATAGGAGGCAGAGCTTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 1, 2: 6, 3: 111, 4: 880}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087177874_1087177878 7 Left 1087177874 11:95111631-95111653 CCTATGAGAATCTAATGCCACAG 0: 20
1: 325
2: 827
3: 1427
4: 1646
Right 1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG 0: 1
1: 1
2: 6
3: 111
4: 880
1087177877_1087177878 -10 Left 1087177877 11:95111648-95111670 CCACAGCTGATCTCATAGGAGGC 0: 1
1: 3
2: 75
3: 524
4: 1063
Right 1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG 0: 1
1: 1
2: 6
3: 111
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087177878 Original CRISPR CATAGGAGGCAGAGCTTAGA CGG Intronic
900771531 1:4548550-4548572 TATAGGAGACAGAGCTGAGCTGG - Intergenic
900789126 1:4667615-4667637 GACAGGAGGCGGAGCTCAGATGG + Intronic
901674800 1:10876919-10876941 CATGGGAGGCAGAGGTTGCAGGG - Intergenic
901719782 1:11187486-11187508 GACAGGAGGCAGAGCTCAGGCGG + Intronic
901928860 1:12584057-12584079 CATAGGAGCCAGAGGTAGGATGG - Intronic
902600114 1:17535281-17535303 GATAGGAAGCAGAGCTCAGGTGG + Intergenic
902800669 1:18827679-18827701 GACAGGAGGCAGAGCTCAGATGG - Intergenic
903744809 1:25579717-25579739 CATTGAAGGCAGAGCTTCGAGGG - Intergenic
904279537 1:29409279-29409301 CAAAGGAGGCAGGGCTGGGATGG - Intergenic
904553626 1:31342638-31342660 GATAGGAGGCGGAGCTCAGGTGG + Intronic
904864827 1:33570241-33570263 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
904970224 1:34413746-34413768 CATGGGAGGCGGAGCTTGCAGGG - Intergenic
905045145 1:34991692-34991714 CCCAGGAGGCAGAGGTTATAGGG + Intronic
905140759 1:35842248-35842270 GACAGGAGGCAGAGCTCAGGTGG - Intronic
905462584 1:38131331-38131353 CAAAGGAGGCAGGGCTTGGATGG + Intergenic
906453088 1:45969490-45969512 GACAGGAGGCAGAGCTCAGGCGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907614192 1:55907162-55907184 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
907733627 1:57090851-57090873 GATAGGAGGTAGAGCTCAGGCGG - Intronic
907828024 1:58037455-58037477 AACAGGAGGCAGAGCTCAGGTGG - Intronic
908263978 1:62360737-62360759 CCTAGGAGGCAGAGTTTGCAGGG + Intergenic
908309045 1:62857253-62857275 GACAGGAGGCAGAGCTCAGGTGG - Intronic
909005446 1:70270656-70270678 GACAGGAGGCAGAGCTCAGGCGG + Intronic
909423054 1:75487931-75487953 GACAGGAGGCAGAGCTCAGGTGG - Intronic
909642405 1:77883377-77883399 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
909994418 1:82261208-82261230 GATGGGAGGCAGAGCTTAGGTGG + Intergenic
911201233 1:95046320-95046342 GATAGGAGGCAGAGCTCAGGTGG - Intronic
911982911 1:104587971-104587993 CATATAAAGCAGAGTTTAGAGGG + Intergenic
912113008 1:106366782-106366804 GATAGGAGGCAGAGCTCAGGTGG + Intergenic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
914964413 1:152241353-152241375 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916185550 1:162129115-162129137 CCAAGGAGGCGGAGCTTAGCTGG - Intronic
916365681 1:164024901-164024923 CATAGGATTCAGTGCTTAAAAGG - Intergenic
916629944 1:166601541-166601563 GACAGGAGGCAGAGCTCAGAAGG + Intergenic
917058730 1:171013309-171013331 GACAGGAGGCAGAGCTCAGGTGG - Intronic
917169685 1:172157307-172157329 GACAGGAGGCAGAGCTCAGGTGG + Intronic
917346249 1:174030900-174030922 GACAGGAGGCAGAGCTGAGGCGG - Intergenic
917987169 1:180332463-180332485 GACAAGAGGCAGAGCTCAGATGG - Intronic
918019593 1:180673588-180673610 GATGGGAGGCAGAGCTCAGGCGG - Intronic
918041309 1:180915766-180915788 GACAGGAGGCAGAGCTCAGGTGG - Intronic
918523967 1:185444920-185444942 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
918573345 1:186025192-186025214 GATAGGAGGCAGCGCTCAGGTGG + Intronic
918699413 1:187589299-187589321 GACAGGAGGCAGAGCTCAGAAGG - Intergenic
918906309 1:190500011-190500033 GACAGGAGGCAGAGCTCAGGAGG - Intergenic
919082515 1:192883414-192883436 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
919265057 1:195252160-195252182 GACAGGAGGCAGAGCTTAGGAGG - Intergenic
919682214 1:200446917-200446939 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
919806634 1:201384546-201384568 CAGAGGAGGCAGGGCTTGGGTGG - Intronic
919811533 1:201411882-201411904 GACAGGAGGCAGAGCTCAGGCGG + Intronic
919935951 1:202251047-202251069 CATAGCAGACAGAGCTGAGAGGG + Intronic
919979540 1:202633761-202633783 CATAAGAGACAGGGCTGAGATGG - Intronic
920318788 1:205101006-205101028 GACAGGAGGCAGAGCTCAGGTGG + Intronic
920374199 1:205498442-205498464 GATAGAAGGCAGAGCTCAGGTGG + Intergenic
920650381 1:207833023-207833045 CTTGGGAGGCAGAGCTTAGTGGG + Intergenic
920973164 1:210759953-210759975 GATAGGAGGCGGAGCTCAGGTGG - Intronic
920989411 1:210922304-210922326 CCTGGGAGGCAGAGCTTGCATGG + Intronic
920993352 1:210961762-210961784 CCTGGGAGGCAGAGGTTACAGGG + Intronic
921016372 1:211195700-211195722 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
921322453 1:213955214-213955236 GACAGGAGGCAGAGCTTAGGTGG + Intergenic
921413180 1:214858757-214858779 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
921425271 1:214994181-214994203 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
921434962 1:215108149-215108171 GACAGGAGGCAGAGCTCAGGTGG + Intronic
921589890 1:216991026-216991048 GACAGGAGGCAGAGCTCAGATGG - Intronic
922254441 1:223880757-223880779 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
922329364 1:224560530-224560552 GAAAGGAGGCGGAGCTTAGGTGG - Intronic
922750996 1:228070013-228070035 CATAGGAGGGATAGCGTAGGGGG + Intergenic
922781399 1:228255885-228255907 GACAGGAGGCAGAGCTCAGGCGG - Intronic
923080187 1:230646007-230646029 CATGGGAGGCAGACCTCAGGAGG - Intronic
923486210 1:234433824-234433846 CCTATGAGGGAGACCTTAGATGG + Intronic
923491191 1:234485601-234485623 GATAGGAGGCGGAGCTCAGGTGG - Intergenic
923534655 1:234839849-234839871 GACAGGAGGCAGAGCTTAGGTGG - Intergenic
923618407 1:235556984-235557006 CACAGGAGGCAGAGCTCAAGCGG + Intronic
923630010 1:235643459-235643481 CAGAGGAGTCAGAACCTAGAGGG - Intronic
923807440 1:237273302-237273324 CACAGGACGCAGAGCTCAGGTGG + Intronic
923826118 1:237502645-237502667 CACAGGGGGCAGAGCTCAGGCGG + Intronic
924407031 1:243758782-243758804 GACAGGAGGCGGAGCTTAGGTGG + Intronic
1063122136 10:3112631-3112653 CATGGGAGGCAGAGATTGCAGGG - Intronic
1063283977 10:4662781-4662803 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1063539182 10:6914800-6914822 AAAGGGAGGCAGAGCATAGAAGG + Intergenic
1063622350 10:7661004-7661026 ATTAGGAGGCAGAGCTCAGCCGG - Intronic
1064020285 10:11803708-11803730 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1064112523 10:12551200-12551222 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1064498381 10:15940095-15940117 AATAGAAGGCAGAGGTGAGAGGG - Intergenic
1064541121 10:16406122-16406144 AACAGGAGGCAGAGTTTAGGCGG - Intergenic
1064882000 10:20065797-20065819 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1064901852 10:20303703-20303725 GACAGGAGGTAGAGCTCAGATGG - Intergenic
1065138074 10:22692289-22692311 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1065672537 10:28135993-28136015 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1065849150 10:29772410-29772432 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
1065931543 10:30483668-30483690 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1067129221 10:43546498-43546520 CCCAGGAGGCAGAGCTTGCAGGG + Intergenic
1067265153 10:44735435-44735457 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1067315201 10:45154909-45154931 GACAGGAGGAAGAGCTCAGATGG - Intergenic
1068036856 10:51770588-51770610 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068209052 10:53896702-53896724 TACAGGAGGCAGAGCTCAGGAGG - Intronic
1068812649 10:61273986-61274008 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1068861766 10:61855000-61855022 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1068929333 10:62573133-62573155 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1069091187 10:64200710-64200732 AAGAGGAAGCAGAGCATAGAGGG + Intergenic
1069575226 10:69522606-69522628 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1069929372 10:71872229-71872251 CACAGGAGGCTGAGCCGAGATGG + Intergenic
1070018506 10:72559842-72559864 GACAGGAGGCAGAGCTTAGTCGG - Intronic
1071517287 10:86306580-86306602 CACAGGAGGGAGAGATTGGAGGG - Intronic
1071681547 10:87710925-87710947 CATAGGAGGCAGAAGTTGCAGGG + Intronic
1071850876 10:89569206-89569228 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1071925084 10:90397306-90397328 CATAAGAGGAAGAACTTAAAGGG - Intergenic
1072225060 10:93361225-93361247 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1072262326 10:93691281-93691303 CTTGGGAGGCTGAGGTTAGAAGG - Intronic
1072411137 10:95203103-95203125 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1073276444 10:102315679-102315701 GACAGGAGGCAGAGTTTAGGTGG + Intronic
1073557831 10:104470246-104470268 CATTTAAAGCAGAGCTTAGAGGG - Intergenic
1073717732 10:106126924-106126946 CATAGGAGGCGGAGGTCAAAGGG - Intergenic
1073839283 10:107479944-107479966 TGCAGGAGGCAGAGCTTAGGCGG + Intergenic
1073962255 10:108945878-108945900 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1074294347 10:112169825-112169847 GACAGGAGGCGGAGCTCAGAGGG - Intronic
1074596080 10:114868267-114868289 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1074729050 10:116349010-116349032 GATAGGAGGCAGAGCTCAGGTGG - Intronic
1074997609 10:118771284-118771306 CATAGGTGGCAGCCCTTAGAGGG - Intergenic
1075256733 10:120931203-120931225 CAGAGGAGGGAGAATTTAGAAGG + Intergenic
1075301076 10:121324768-121324790 GATAGGAGGCGGAGCTCAGGTGG + Intergenic
1076160985 10:128244184-128244206 CAGAGAAGGCAGAGCTGGGATGG - Intergenic
1076284680 10:129282000-129282022 CATAGGAGGGAGAGGGTAGAGGG - Intergenic
1076284932 10:129285621-129285643 GACAGGAGGCGGAGCTCAGATGG + Intergenic
1077426480 11:2481632-2481654 GATAGGAGGCAGAGCTCACGCGG - Intronic
1077860826 11:6178315-6178337 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1078152494 11:8771220-8771242 CAGAGGAGGCAAAGCTAAAATGG + Intronic
1078476306 11:11633282-11633304 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1078704293 11:13724472-13724494 CCTAGGAGGCAGAGGTTGCAGGG + Intronic
1078949713 11:16116785-16116807 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1078959716 11:16250118-16250140 CACAGGAGGCAGAGCTCAGGTGG - Intronic
1078999783 11:16741670-16741692 AACAGGAGGCAGAGCTCAGGTGG - Intronic
1079082438 11:17423279-17423301 CCTAGGAGGCAGAGCTTGTGAGG + Intronic
1079149852 11:17887983-17888005 GACAGGAGGCGGAGCTCAGATGG - Intronic
1079666055 11:23107049-23107071 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1079814776 11:25041843-25041865 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1079906076 11:26248853-26248875 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1080031180 11:27662739-27662761 GAAAGGAGACAGAGCTCAGATGG + Intronic
1080244518 11:30164357-30164379 GACAGGAGGCGGAGCTCAGATGG + Intergenic
1080471511 11:32550410-32550432 GACAGGAGGCAGAGCTCAGGAGG - Intergenic
1080739835 11:35053432-35053454 GACAGGAGGCAGAGCTCAGATGG - Intergenic
1080832003 11:35903549-35903571 GACAGGAGGCAGAGCTTAGGTGG + Intergenic
1080969028 11:37247592-37247614 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1081499421 11:43651654-43651676 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1081841795 11:46207487-46207509 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1083576699 11:63797082-63797104 GAAAGGAGGCAAAGCTTAGGTGG + Intergenic
1083964831 11:66037011-66037033 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1084570728 11:69958203-69958225 CTTAGGAGGCTGAGCTCAGAAGG - Intergenic
1084838269 11:71822273-71822295 CCCAGGAGGCAGAGATTACAGGG + Intergenic
1085427745 11:76419904-76419926 CATAAGTGGCAGAGCTGGGATGG + Intergenic
1085472195 11:76765571-76765593 CAGGGGAGGCAGAGCTTAGCTGG - Intergenic
1085591332 11:77764120-77764142 CAGAGGAAGCAGAGCTCACATGG + Intronic
1085616345 11:78002282-78002304 CCTAGGAGGCAGAGGTTACAGGG - Intergenic
1085800234 11:79582594-79582616 CAAGAGAAGCAGAGCTTAGAAGG - Intergenic
1086345713 11:85893659-85893681 GACAGGAGGCGGAGCTCAGACGG - Intronic
1086472648 11:87131875-87131897 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1086848414 11:91780195-91780217 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1087454878 11:98372313-98372335 GACAGGAGGCAGAGCTTAAGCGG + Intergenic
1087457290 11:98403258-98403280 GACAGGAGGCAGAACTCAGATGG + Intergenic
1087714099 11:101587036-101587058 CACAGGAGGCAAAGCTCAGGCGG + Intronic
1087886478 11:103488831-103488853 GACAGGAGGCAGAGCTCAGCTGG - Intergenic
1088016930 11:105072136-105072158 CTTGGGAGGCAGAGCTGAGAGGG - Intronic
1088136284 11:106559664-106559686 GATAGGAGGCTGAGCTCAGGTGG - Intergenic
1088633058 11:111792747-111792769 CATAGAAGGAAAAGCTAAGAAGG + Intronic
1089223759 11:116897805-116897827 CCTGGGAGGCAGAGATTACAGGG + Intronic
1089740753 11:120580642-120580664 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089825086 11:121267855-121267877 CACAGGAGGCTAATCTTAGATGG - Intergenic
1090205687 11:124882845-124882867 CACAGGAAGCAGAGCCTAAAAGG - Intergenic
1090207511 11:124894049-124894071 TATGGGATGCAGAGCTCAGAGGG + Intronic
1090485372 11:127107872-127107894 GATAGGAGGCAGAGCTCAGGCGG - Intergenic
1091032911 11:132207249-132207271 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1091755256 12:3047130-3047152 GACAGGAGGCAGAGCTCAGACGG - Intergenic
1091788564 12:3257880-3257902 CAGAGGAGGAGGATCTTAGATGG + Intronic
1092110619 12:5960974-5960996 GACAGGAGGCAGAGCTCAGTTGG - Intronic
1092131182 12:6114355-6114377 CACAGGAGGCAGAGCTGAGCGGG + Intronic
1092164840 12:6336468-6336490 CATAGGAAGAAGGGATTAGATGG - Intronic
1092776191 12:11946864-11946886 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1093104419 12:15068787-15068809 CACAGGAGGCAGAGTTCAGATGG - Intergenic
1093168745 12:15835569-15835591 AACAGGAGGCAGAGCTCAGGTGG - Intronic
1093331135 12:17841660-17841682 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1093443027 12:19222012-19222034 CTCAGGAGGCTGAGGTTAGAAGG + Intronic
1093509711 12:19911996-19912018 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1093662042 12:21768203-21768225 GACAGGAGGCAGAGCTCAGGAGG + Intronic
1094075146 12:26464444-26464466 AAGAGGAGGCAGAGCTCAGGTGG + Intronic
1094242769 12:28247955-28247977 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1094546869 12:31412560-31412582 GACAGGAGGCGGAGCTTAGGCGG + Intronic
1094645764 12:32322510-32322532 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1094720196 12:33055287-33055309 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1095487514 12:42700199-42700221 TGTAGGAGGCAGAACTCAGATGG - Intergenic
1095764300 12:45877285-45877307 AACAGGGGGCAGAGCTTAGGTGG - Intronic
1095950586 12:47779775-47779797 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1096019266 12:48308503-48308525 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
1096723338 12:53540837-53540859 CTTAGGAGGCTGAGCCTAGGAGG - Intronic
1097637966 12:62145280-62145302 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1097906640 12:64926592-64926614 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1098031625 12:66260740-66260762 GATAGGAGGCAGAGCTCAGGTGG - Intergenic
1098140485 12:67445613-67445635 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1098399313 12:70056657-70056679 AATAGGAGGCAGGGGTAAGAAGG - Intergenic
1098914578 12:76243967-76243989 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1099012107 12:77303589-77303611 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1099248950 12:80228364-80228386 CCTAGGAGGCAGAGGTTTCAGGG + Intronic
1099252442 12:80272811-80272833 CATAGGAGGCAGAGACAAGAAGG + Intronic
1099352826 12:81593996-81594018 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1099564002 12:84217042-84217064 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1099810053 12:87569149-87569171 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1100769135 12:97901983-97902005 CCCAGGAGGCAGAGCTTACAGGG - Intergenic
1100781717 12:98033886-98033908 TACAGGAGGCAGAGCTTTCAGGG - Intergenic
1101024221 12:100584962-100584984 CCCAGGAGGCAGAGCTTGCAGGG - Intronic
1101159238 12:101956441-101956463 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1101263348 12:103058029-103058051 CAAGGGAGGCAGAGGTTAGAGGG - Intergenic
1101375545 12:104168258-104168280 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1101721432 12:107353720-107353742 GATAGGAGGCAGAGCTCAGGCGG - Intronic
1104246827 12:127051101-127051123 GACAGGAGGCAGAGCTCAGATGG - Intergenic
1104824413 12:131698551-131698573 GACAGGAGGCAGAGCTCAGACGG - Intergenic
1105285436 13:18999638-18999660 CATAGGAGCCAGGGCAGAGATGG + Intergenic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106062741 13:26310618-26310640 GACAGGAGGCAGAGCTTAGGTGG + Intronic
1106065846 13:26348379-26348401 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1106397460 13:29394758-29394780 GACAGGAGGCAGAGCTCAGGAGG - Intronic
1106398413 13:29403945-29403967 AATATGAGGAAGAGTTTAGATGG - Intronic
1106538473 13:30669037-30669059 CACAGAAGCCAGAGCTTATAGGG + Intergenic
1106639014 13:31563401-31563423 AACAGGAGGCAGAGCTCAGATGG - Intergenic
1106957251 13:34953844-34953866 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1107327959 13:39265200-39265222 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1107441733 13:40433819-40433841 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1107729331 13:43332376-43332398 AACAGGAGGCAGAGCTCAGGTGG + Intronic
1107754820 13:43608970-43608992 AATAACTGGCAGAGCTTAGAAGG - Intronic
1107804345 13:44140398-44140420 GATGGGAGGCAGAGCTCAGGCGG - Intergenic
1107874492 13:44778131-44778153 GATAGGAGGCAGAACTCAGGTGG + Intergenic
1108427548 13:50319054-50319076 GACAGGAGGCTGAGCTCAGAGGG - Intronic
1108515216 13:51195098-51195120 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1109770378 13:66963124-66963146 GATGGGAGGCAGAGCTCAGGCGG + Intronic
1109962055 13:69644401-69644423 AATAGGAAGCAGAGCATAAATGG + Intergenic
1110482406 13:75994967-75994989 GATAGGAGTCAGAGCTCAGGTGG + Intergenic
1110552458 13:76824767-76824789 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1110649508 13:77926660-77926682 CAGAGGTGGAAGAGTTTAGAGGG - Intergenic
1110711173 13:78652771-78652793 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1110745111 13:79043395-79043417 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1111201262 13:84940385-84940407 GACAGGAGGCGGAGCTCAGATGG - Intergenic
1111460659 13:88537196-88537218 GACAGGAGGCAGAACTCAGATGG + Intergenic
1112115313 13:96346064-96346086 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1112616026 13:101006412-101006434 CACAGGAGGTGGAGCTTGGATGG + Intergenic
1113019386 13:105866254-105866276 CCTGGGAGGCAGAGATTACAGGG + Intergenic
1113369444 13:109709440-109709462 GACAGGAGGCGGAGCTTAGGTGG - Intergenic
1113626663 13:111852943-111852965 GACAGGAGGCGGAGCTTAGGTGG - Intergenic
1113658384 13:112085886-112085908 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1113720418 13:112552033-112552055 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1113968026 13:114165663-114165685 CCTAAGAGGCAGAGTTTAGAAGG - Intergenic
1113978313 13:114249269-114249291 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1114219242 14:20682482-20682504 CACAGGAGGCGGAGCTCAGGCGG - Intergenic
1114220513 14:20692485-20692507 GGCAGGAGGCAGAGCTTAGGCGG - Intronic
1114333326 14:21660265-21660287 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1114581978 14:23769476-23769498 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1114634407 14:24179264-24179286 CATAGGTGGGAGAGCTGAGGAGG - Intronic
1114862368 14:26540223-26540245 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1115053273 14:29091204-29091226 GAAAGGAGGCAGAGCTCAGGTGG - Intergenic
1115528437 14:34304066-34304088 CATAGGAGGGAGAATTGAGATGG - Intronic
1115683394 14:35767294-35767316 GATATAAGGCAAAGCTTAGAGGG + Intronic
1116438237 14:44919376-44919398 TCCAGGAGGCAGAGCTTGGAGGG + Intergenic
1116502697 14:45639519-45639541 GACAGGAGGCAGAGCTTAGGTGG + Intergenic
1116522625 14:45869016-45869038 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1116588447 14:46740117-46740139 GACAGGAGGCAGAGCTAAGGTGG - Intergenic
1117322188 14:54634588-54634610 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1117432208 14:55678748-55678770 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1117630369 14:57684515-57684537 GAGAGGAGGCAGAGCTCAGGTGG + Intronic
1117995987 14:61478750-61478772 CACAGGAGGCTGAGGTTGGAAGG + Intronic
1118391192 14:65297155-65297177 TATAGGAGGCATAGCTGAGGAGG - Intergenic
1119037905 14:71246153-71246175 CAAAGGAGGCAGTGCTGTGAGGG + Intergenic
1119123229 14:72099233-72099255 CCCAGGAGGCAGAGCTTGCAGGG - Intronic
1119516041 14:75249172-75249194 CAGAGGAGGCAGGTCTTTGAGGG + Intronic
1119718844 14:76877490-76877512 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1119882373 14:78110984-78111006 AGCAGGAGGCAGAGCTCAGATGG - Intergenic
1120135289 14:80859885-80859907 TATAGGATGCAGAGATTTGAAGG - Intronic
1120149790 14:81020414-81020436 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1120508898 14:85388522-85388544 CATAGAAGGCAGAACTGAGGGGG - Intergenic
1120635714 14:86948466-86948488 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1121170564 14:91850526-91850548 CACAGGAGGCAGAGCTCAGGTGG - Intronic
1121757404 14:96414580-96414602 CATAGGAGGCAGAGCTCAGAAGG + Intronic
1121799665 14:96764130-96764152 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1122170035 14:99865314-99865336 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1122305496 14:100763578-100763600 GACAGGAGGCAGAGCTCAGCAGG + Intergenic
1122305654 14:100764742-100764764 GACAGGAGGCAGAGCTCAGCAGG + Intergenic
1122535130 14:102456663-102456685 CCCAGGAGGCAGAGCTTGCAGGG - Intronic
1122660031 14:103288975-103288997 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1122911841 14:104833609-104833631 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1124440315 15:29681225-29681247 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1125135188 15:36333092-36333114 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1125560673 15:40630565-40630587 GAAAGGAGGCAGAGCTCAGTTGG - Intronic
1125835567 15:42747622-42747644 GATAGGAGGCGGAGCTCAGGCGG + Intronic
1126020917 15:44400650-44400672 CCCAGGAGGCAGAGCTTGCAGGG - Intronic
1126148348 15:45499145-45499167 CTCAGGAAGCAGAGCTGAGATGG - Intronic
1126393344 15:48183114-48183136 CATAGGAGACAGAACTTAGAAGG + Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126524082 15:49630846-49630868 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1127192829 15:56549948-56549970 TATAGGATGCAGGCCTTAGATGG - Intergenic
1127583951 15:60364098-60364120 GAGAGGAGGCAGAGCGCAGATGG - Intronic
1127681479 15:61302501-61302523 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1127692258 15:61408902-61408924 CTTAGGAGGCAGAGGATAGCAGG + Intergenic
1128033456 15:64502039-64502061 CCTGGGAGGCAAAGCTTATATGG - Intronic
1128063045 15:64747345-64747367 CACAGGAGCCAGAGCTGAGGCGG - Intronic
1128130393 15:65223504-65223526 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1128645324 15:69374599-69374621 CCCAGGAGGCAGAGCTTGCAGGG + Intronic
1129430606 15:75498637-75498659 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1129993341 15:79983788-79983810 CATAGGAGGTGTAGGTTAGAAGG - Intergenic
1129998220 15:80025138-80025160 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1130044443 15:80432765-80432787 CACAGGAGGCTGAGCTGTGATGG - Intronic
1130701893 15:86191991-86192013 CTTAGGAGGCTGAGGTTGGAGGG + Intronic
1130722803 15:86405997-86406019 CACAGCAGGCACAGCCTAGAGGG + Intronic
1131349916 15:91690182-91690204 GATGGGAGGCAGAGCTCAGGAGG + Intergenic
1131488705 15:92843497-92843519 GACAGGAGGCAGAGCTTAGGCGG - Intergenic
1131627685 15:94140191-94140213 CAGTGGAGGCAGTGCATAGAAGG - Intergenic
1131631934 15:94186733-94186755 GATAGGAGGCAAAGCTCAGGTGG + Intergenic
1131714591 15:95094743-95094765 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1132776573 16:1598380-1598402 CCTAGGAGGCGGAGCTTGCAGGG + Intronic
1133080574 16:3315845-3315867 CATAGGAGCCAGACCATGGAGGG - Intronic
1133190936 16:4133326-4133348 CCTGGGAGGCAGAGGTTACAGGG - Intergenic
1133353543 16:5119187-5119209 GACAGGAGACAGAGCTTAGGTGG + Intergenic
1133549362 16:6839058-6839080 CCCAGGAGGCAGAGGTTACAGGG - Intronic
1133918769 16:10133176-10133198 TACAGGAGTCAGAGTTTAGAAGG + Intronic
1134176142 16:12008017-12008039 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
1134662116 16:15992037-15992059 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1135277559 16:21126754-21126776 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1135598039 16:23758097-23758119 GACAGGAGGCAGAGCTCAGGCGG + Exonic
1135852747 16:25979417-25979439 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136676822 16:31917529-31917551 GAGAGGAGGCAGAGCTCAGGTGG - Intergenic
1137332414 16:47512038-47512060 GAGAGGAGGCAGAGCTCAGGCGG + Intronic
1137864316 16:51877441-51877463 CATAGGAATCAGACCTTGGAGGG - Intergenic
1137909903 16:52367004-52367026 CATAGGAGGCACAGAATAAAAGG - Intergenic
1138377118 16:56571912-56571934 GACAGGAGGCAGAGCTCAGACGG + Intergenic
1138420495 16:56895965-56895987 GACAGGAGGCAGAGGTCAGATGG + Intronic
1138620607 16:58208084-58208106 GACAGGAGGCAGAACTTAGGTGG - Intergenic
1138979668 16:62251934-62251956 TATAGTATGCAGGGCTTAGAAGG - Intergenic
1139392548 16:66614137-66614159 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1139430882 16:66910506-66910528 CAGAGGAGGCAGTGCTGAGCTGG + Intronic
1139747606 16:69087203-69087225 AAGAGGAGGAAGAGCCTAGAAGG - Intergenic
1140358646 16:74326567-74326589 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1140599528 16:76458639-76458661 GATAGGAGGCAGAGCTCAGGTGG + Intronic
1140606582 16:76546379-76546401 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1140688039 16:77452420-77452442 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1140787903 16:78361685-78361707 CACAGGAGGCAGAGGTTGCAGGG - Intronic
1141069603 16:80941885-80941907 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1141876930 16:86831595-86831617 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1142630822 17:1225071-1225093 CCCAGGAGGCAGAGCTTGCAGGG + Intronic
1143019246 17:3908125-3908147 CCCAGGAGGCAGAGCACAGAGGG + Intronic
1143066044 17:4248252-4248274 CACAGGAGGCGGAGCTCAGGTGG - Intronic
1143093768 17:4465649-4465671 CACAGGAGGCGGAGGTTATAGGG + Intronic
1143209592 17:5175265-5175287 AACAGGAGGCAGAGCTCAGGCGG - Intergenic
1143748464 17:9011121-9011143 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1143814484 17:9500927-9500949 CCCAGGAGGCAGAGCTTGCAGGG + Intronic
1144617815 17:16792456-16792478 AACAGGAGGCAGAGCTCAGGCGG + Intronic
1144619071 17:16804725-16804747 AACAGGAGGCAGAGCTCAGGCGG - Intergenic
1144893629 17:18510970-18510992 AACAGGAGGCAGAGCTCAGGCGG + Intergenic
1144894889 17:18523226-18523248 AACAGGAGGCAGAGCTCAGGCGG - Intergenic
1145137334 17:20421008-20421030 AACAGGAGGCAGAGCTCAGGCGG + Intergenic
1145138594 17:20433304-20433326 AACAGGAGGCAGAGCTCAGGCGG - Intergenic
1145725192 17:27114304-27114326 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1145834695 17:27945439-27945461 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1146135377 17:30316041-30316063 CAGAGGTTGCAGAGCTGAGATGG - Intergenic
1146721749 17:35129013-35129035 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1147012446 17:37461255-37461277 GACAGGAGGCAGAGTTCAGACGG + Intronic
1147120408 17:38332135-38332157 CAGGGCAGGCAGAGCTCAGAGGG + Intronic
1147919273 17:43906434-43906456 TCTCGGAGGCAGAGCTGAGAGGG - Intronic
1148186073 17:45644773-45644795 TATAGGAAGCAAAGCTTGGAGGG - Intergenic
1149082318 17:52673937-52673959 CCTAGGATGCAGGGCTTAGGAGG - Intergenic
1149229813 17:54519638-54519660 CATAGGAGGCAGGGCCAAGAAGG - Intergenic
1149314690 17:55427958-55427980 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1149546145 17:57505256-57505278 CATAGGGGAGAGAGCTCAGATGG + Intronic
1149640532 17:58199748-58199770 CAAAGAAGGCAGAGCTAAGTGGG - Exonic
1149774127 17:59344007-59344029 CATAGAAGGGAGAGCATAAAGGG + Intronic
1149953547 17:61019172-61019194 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1150317694 17:64183500-64183522 CCTGGGAGGCAGAGGTTACAGGG - Intronic
1150366353 17:64589567-64589589 GATAGGAGGCAGAGCTCGGGTGG - Intronic
1150467935 17:65410734-65410756 GAAAGGAGGTAGAGCTCAGACGG + Intergenic
1151049809 17:70964720-70964742 CATAGGCTCCAGAGCATAGAGGG - Intergenic
1151049905 17:70965727-70965749 CATAGGCTCCAGAGCATAGAGGG - Intergenic
1153386605 18:4504718-4504740 GATAGGAGGCAGAGCTCAGGTGG - Intergenic
1153464539 18:5374625-5374647 CAGATGATGCAGAGCTTTGAAGG - Intergenic
1153495708 18:5696636-5696658 GATAGGAGGCAGAGCTCAGGTGG - Intergenic
1153758553 18:8307726-8307748 CCCAGGAGGCAGAGCTTTCAGGG + Intronic
1153912229 18:9714414-9714436 GACAGGAGGCAGAGCTCAGCTGG + Intronic
1153955373 18:10091427-10091449 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1155528156 18:26738552-26738574 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1155702191 18:28760509-28760531 CACAGGAGGAGGAGCTTAGGTGG - Intergenic
1155865610 18:30960891-30960913 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1156009638 18:32481585-32481607 GATAGGAGGCAGAGCTCAGGCGG + Intergenic
1156034092 18:32747560-32747582 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1156215747 18:34996431-34996453 GACAGGAGGCAGAGCTTAAGTGG + Intronic
1156823323 18:41399185-41399207 GACAGGAGGCAGAGCTTAGGTGG - Intergenic
1157036445 18:43980418-43980440 CACAGAAGGCAGAGATTACAAGG - Intergenic
1157472523 18:48000918-48000940 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1158174383 18:54637911-54637933 CAAAGGAGGAAGAACTAAGAGGG + Intergenic
1158218248 18:55122753-55122775 CATAGTAGCCAGCACTTAGATGG - Intergenic
1158220881 18:55149612-55149634 CCAAAGAGGCAGAGCTGAGAAGG - Intergenic
1158584381 18:58718437-58718459 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1158608096 18:58913894-58913916 CAGAGGAGGCAGACCTTGGCTGG + Intronic
1158763120 18:60414278-60414300 GATGGGAGGCAAAGCTTAGGTGG + Intergenic
1158865123 18:61631178-61631200 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
1159057804 18:63483672-63483694 CAATGGAGGCAGAGATTGGAGGG - Intronic
1159381967 18:67671640-67671662 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1159452283 18:68617921-68617943 CCCAGGAGGCAGAGCTTGCAGGG - Intergenic
1159903043 18:74065999-74066021 TAGAGGAGGCAGGGCTTAGAAGG + Intergenic
1159934228 18:74349507-74349529 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1160078720 18:75703192-75703214 GACAGGAGGTAGAGCTCAGAGGG + Intergenic
1160213121 18:76901029-76901051 GACAGGAGGCGGAGCTCAGATGG + Intronic
1160245807 18:77158583-77158605 GATGGGAGGCAGAGCTCAGGTGG + Intergenic
1160281350 18:77493740-77493762 TGTAGGAGGCAGAGCTCAGGCGG - Intergenic
1160755370 19:754385-754407 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1160935016 19:1590508-1590530 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1161645748 19:5452254-5452276 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1162171166 19:8790211-8790233 CCGAGGAGGCAGAGCTTGCAGGG - Intergenic
1162771475 19:12951996-12952018 CACAGGAGGCAGAGGTTGCAGGG - Intronic
1163029839 19:14537051-14537073 AGTAGGAGGCAGAGTTTAGCAGG + Intronic
1163121128 19:15218724-15218746 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1163642995 19:18472452-18472474 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1165285992 19:34842018-34842040 GACAGGAGGCGGAGCTTAGGCGG - Intergenic
1165317265 19:35064422-35064444 CCTAGGAGGCAGAGTTTGCAGGG - Intronic
1165616326 19:37204820-37204842 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1165812448 19:38619682-38619704 CAAAGGAGGCGGAGCAGAGAAGG - Intronic
1165839955 19:38782560-38782582 CCCAGGAGGCAGAGCTTGCAGGG + Intergenic
1166285511 19:41824563-41824585 CCCAGGAGGCAGAGCTTGCAGGG - Intergenic
1166287317 19:41839214-41839236 CATACGAGGCAGAGTGGAGATGG + Exonic
1166526119 19:43510918-43510940 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1167238162 19:48327329-48327351 CATCGGAGGTAGAGCTAAAAGGG - Intronic
1167279481 19:48558516-48558538 AATAAGAGGCAGAGATCAGAAGG - Intronic
1167690567 19:50982132-50982154 CACAGGAGGCAGGGCCTGGAGGG + Intronic
1167957097 19:53074592-53074614 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1167998619 19:53426610-53426632 CACAGAAGGCAGAGCTCAGGTGG - Intronic
1168008743 19:53512721-53512743 CACAGGAGGCAGAGCTCAGGTGG - Intergenic
1168392825 19:56024949-56024971 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1168418266 19:56183266-56183288 AGTGGCAGGCAGAGCTTAGAGGG + Intronic
1168455317 19:56503003-56503025 CACAGGAAGCAGAGCTCAGGCGG - Intergenic
925198346 2:1946065-1946087 GACAGGAGGCAGAGCTCAGGTGG - Intronic
926233138 2:11019898-11019920 GAGAGGAGGCAAAGCCTAGAGGG - Intergenic
926701510 2:15807258-15807280 GAGAGGAGGCAGAGCTCAGGCGG - Intergenic
926903576 2:17784986-17785008 GACAGGAGGCAGAGCTCAGGCGG - Exonic
927228043 2:20789736-20789758 GACAGGAGGCAGAGCTCAGGCGG - Intronic
927618524 2:24625648-24625670 CAGAGAAGGCAGTGTTTAGAGGG - Intronic
928328721 2:30340643-30340665 CTCAGGAGGCTGAGATTAGATGG + Intergenic
928477472 2:31644572-31644594 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
928658118 2:33474035-33474057 GACAGGAGGCAGAGCTCAGATGG + Intronic
929058207 2:37897094-37897116 GAAAGGAGGCAGAGCTTACGAGG + Intergenic
929460271 2:42098156-42098178 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
929474598 2:42233379-42233401 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
929569232 2:43009618-43009640 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
929762695 2:44819221-44819243 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
930180571 2:48351699-48351721 GACAGGAGGCAGAGCTCAGGTGG + Intronic
930422730 2:51174826-51174848 CACAGGGGGCAGAGCTCAGGCGG - Intergenic
930706771 2:54512098-54512120 GACAGGAGGCAGAGCTCAGATGG + Intronic
930797156 2:55405645-55405667 GACAGGAGGCAGAGCTCAGGTGG - Intronic
931334320 2:61323437-61323459 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
931731042 2:65153678-65153700 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
931774767 2:65531093-65531115 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
932134024 2:69212912-69212934 CTTAGGAGGCTGAGGTGAGAGGG - Intronic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
932568094 2:72922030-72922052 AATAGGAGGCAGAGGTGTGAAGG - Intronic
932605214 2:73160879-73160901 GACAGGAGGCAGAGCTTAGGTGG + Intergenic
932748413 2:74354649-74354671 GACAGGAGGCAGAGCTCAGGCGG + Intronic
932783363 2:74578081-74578103 GACAGGAGGCGGAGCTCAGATGG + Intronic
933074676 2:77907949-77907971 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
933423118 2:82077290-82077312 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
933480712 2:82853813-82853835 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
934767959 2:96891062-96891084 CTGAGCAGGCAGAGCTTATATGG - Intronic
935055857 2:99566150-99566172 CATAGGAGGCAGAGGTTGCAGGG - Intronic
935296953 2:101657983-101658005 CTTAGGAAACAGGGCTTAGAGGG + Intergenic
935753505 2:106259662-106259684 CCTGGGAGGCAGAGCTTGTAGGG + Intergenic
935928439 2:108095758-108095780 CATCAGAAGCAGAGCTCAGAGGG + Intergenic
937363256 2:121243579-121243601 CACGGGAGGCAGAGCTTAGACGG - Intronic
937850366 2:126626989-126627011 GACAGGAGGCAGAGCTTAGGCGG + Intergenic
938630464 2:133161031-133161053 GACAGGAGGCAGAGCTCAGGTGG - Intronic
938685708 2:133735521-133735543 CACAAGAGACAGAGCTTAGCAGG - Intergenic
938716678 2:134027901-134027923 CACAGGAGGCTGAGCTGAGGGGG + Intergenic
938876495 2:135536806-135536828 GACAGGAGGCAGAGCTCAGGTGG - Intronic
939167535 2:138655507-138655529 CAAAGAAGGCAGAGCTTGGATGG - Intergenic
939254723 2:139728203-139728225 GATAGGAGGTAGAGCTCAGGGGG - Intergenic
939291626 2:140203504-140203526 TTCAGGAGGCAGAGCTCAGAAGG + Intergenic
939478795 2:142721156-142721178 CATAGGAGGCAGAGATCAATGGG + Intergenic
940138398 2:150465019-150465041 CTCAGGAGGCAGATATTAGAGGG + Intergenic
940225891 2:151400777-151400799 CAGAGGTTGCAGAGCTGAGATGG - Intergenic
940233464 2:151483779-151483801 GACAGGAGGCAGAGCTCAGGTGG - Intronic
940635362 2:156292533-156292555 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
940973538 2:159919661-159919683 CATAAAAGGAAGAGTTTAGAAGG - Intergenic
940991138 2:160097946-160097968 CATAAGAGACAGAGATAAGAAGG - Intergenic
941075961 2:161007074-161007096 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
941327845 2:164139992-164140014 GACAGCAGGCAGAGCTTAGGCGG + Intergenic
941509001 2:166382700-166382722 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
941942704 2:171059876-171059898 GACAGGAGGCCGAGCTTAGGCGG + Intronic
942305166 2:174600084-174600106 GATAGGAGGCAGAGCTCAGGAGG + Intronic
942840035 2:180349140-180349162 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
943334502 2:186597721-186597743 GACAGGAGGCAGAGCTCAGGTGG - Intronic
944068733 2:195646725-195646747 GATAGGAGGCAAAGCTCAGGCGG - Intronic
944290753 2:198001794-198001816 GACAGGAGGCAGAGCTCAGGTGG - Intronic
944775864 2:202963837-202963859 GACAGGAGGCAGAGCTCAGGAGG + Intronic
945458182 2:210072680-210072702 GACAGGAGGCAGAGCTCAGGCGG + Intronic
946296159 2:218785254-218785276 GACAGGAGGCAGAGCTCAGGTGG + Intronic
946584530 2:221169948-221169970 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
946749798 2:222882615-222882637 GACAGGAGGCAGAGCTCAGGCGG + Intronic
946867719 2:224057669-224057691 AACAGGAGGCAGAGCTCAGGTGG + Intergenic
946880411 2:224171546-224171568 CACAGGGGCCAGGGCTTAGAGGG - Intergenic
947340404 2:229132296-229132318 CAAAGGAGCCAGAGCTTGAAGGG - Intronic
947561721 2:231159963-231159985 GACAGGAGGCAGAGCTCAGGTGG + Intronic
947704614 2:232264192-232264214 GACAGGAGGCAGAGCTCAGGTGG + Intronic
947829386 2:233128084-233128106 GACAGGAGGCAGAGCTCAGGTGG - Intronic
948306539 2:236952298-236952320 GACAGGAGGCAGAGCTCAGATGG - Intergenic
948340930 2:237251022-237251044 GACTGGAGGCAGAGCTTAGGCGG - Intergenic
948914416 2:241025131-241025153 TACAGGAGGCAGAGCTCAGGTGG - Intronic
949073423 2:242040330-242040352 CACAGGAGGGAGAGCTCAGCGGG + Intergenic
1168738481 20:166652-166674 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1168953952 20:1821218-1821240 CAGAGGAAGCAGAGTTTAGTGGG - Intergenic
1169640030 20:7741428-7741450 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1169707205 20:8518986-8519008 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1169764257 20:9131711-9131733 GATAGGAGGCAGAGTTCAGCAGG - Intronic
1170670800 20:18431324-18431346 CATAGAAGGAAGAGCGCAGATGG + Intronic
1170806056 20:19632881-19632903 CATAGGAGGCAAAGTCTACATGG - Intronic
1171365701 20:24622499-24622521 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1171757357 20:29123241-29123263 CACAGGAGGCAGAGCTTTCAGGG - Intergenic
1172105759 20:32516466-32516488 CACTGGAGGAAGAGCTGAGAGGG + Intronic
1172500669 20:35424305-35424327 CATGGGAGGCAGAGGTTTCAGGG + Intergenic
1172813933 20:37671520-37671542 CAGAGGAGGCTGGGCTTGGAGGG + Intergenic
1173665787 20:44762190-44762212 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1173719025 20:45237107-45237129 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174551260 20:51363359-51363381 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1174868901 20:54165204-54165226 GAGAGGAGGCAGAGCTCAGGTGG - Intronic
1175148891 20:56917442-56917464 CAAAGCAGGCAGAGTTGAGAGGG - Intergenic
1175411148 20:58770267-58770289 CCGAGGAGGCAGAGCTTTCAGGG - Intergenic
1175656892 20:60778877-60778899 AAGTGGAGGCAGAGCTTGGAGGG + Intergenic
1175686724 20:61035157-61035179 CAAAGAAGACAGTGCTTAGAGGG - Intergenic
1175902434 20:62365444-62365466 CAGAGGAGACAGATCTGAGAGGG + Intronic
1176053983 20:63134877-63134899 CAGGGGAGGCAGGGCCTAGAGGG + Intergenic
1177043024 21:16136012-16136034 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1177173413 21:17678203-17678225 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1177243343 21:18490137-18490159 GACAGGAGGCAGAGCTTAGGTGG + Intergenic
1177427570 21:20943953-20943975 CATACGAAGCAGAGGTTAAACGG + Intergenic
1177524697 21:22276320-22276342 GACAGGAGGTAGAGCTCAGATGG - Intergenic
1177538706 21:22463753-22463775 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1177679208 21:24341973-24341995 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1177705183 21:24695159-24695181 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1178150497 21:29788870-29788892 AACAGGAGGCAGAGCTCAGGTGG + Intronic
1178296260 21:31412891-31412913 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1178319735 21:31596263-31596285 GACAGGAGGCAGAGCTCACATGG - Intergenic
1178971216 21:37178850-37178872 CTTGGGAGGCTGAGCTGAGAGGG + Intronic
1179058245 21:37955635-37955657 GATAGGAGGCAGAGCTCAGATGG + Intronic
1180249399 21:46571090-46571112 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1180678987 22:17610021-17610043 CATAGGAGGCTGAGGTGGGAAGG + Intronic
1181010820 22:20039551-20039573 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1181098263 22:20521170-20521192 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1181415424 22:22755537-22755559 CATAGGTGACAGAGCCTACAAGG - Intronic
1182202323 22:28586201-28586223 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1182447761 22:30399437-30399459 CCCGGGAGGCAGAGCTTACAGGG + Intronic
1182515116 22:30853831-30853853 CCGAGGAGGCAGAGCTGAGATGG - Intronic
1182580314 22:31305014-31305036 GACAAGAGGCAGAGCTCAGATGG - Intergenic
1182973309 22:34598105-34598127 TATAGGTGGCAGAACTGAGATGG + Intergenic
1183053526 22:35285616-35285638 CTTGGGAGGCAGAGGTGAGAGGG + Intronic
1183062972 22:35346892-35346914 GAAAGGAGGCAGAGGTTAGCCGG - Intronic
1183118781 22:35713490-35713512 CGGAGGATGGAGAGCTTAGAGGG - Intergenic
1184005496 22:41705245-41705267 CCCAGGAGGCAGAGATTACAAGG - Intronic
1184213103 22:43048529-43048551 CACAGGAGGCTGAGGTGAGAAGG + Intronic
1184611236 22:45605074-45605096 CCCAGGAGGCAGAGGTTATATGG - Intergenic
1184701415 22:46176061-46176083 CCTAGGAGGCAGAGGTTGCAAGG + Intronic
1184783260 22:46659500-46659522 CATAGCAGGCAGTGCTCAGCTGG - Intronic
1184883462 22:47327189-47327211 GATGGGAGGCAGAGCTCAGGTGG + Intergenic
1184932988 22:47695296-47695318 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
949293671 3:2495590-2495612 GATAGGAGGCAGAGCTCAGGAGG - Intronic
949361625 3:3238179-3238201 GACAGGAGACAGAGTTTAGATGG - Intergenic
949434437 3:4013226-4013248 GACAGGAGGCAGAGCTCAGGTGG + Intronic
949475484 3:4441156-4441178 GACAGGAGGCAGAGCTCAGGTGG - Intronic
949510055 3:4759637-4759659 CATATGAAGCAGAGCAAAGAGGG - Intronic
949564274 3:5230525-5230547 GAGAGGAGGCAGAGCTCAGGTGG - Intergenic
949835508 3:8265259-8265281 CATAGAAGGTATAGCTTAAAAGG + Intergenic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
950219050 3:11180480-11180502 GACAGGAGGCAGAGCTCAGGTGG + Intronic
951000943 3:17559214-17559236 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
951011836 3:17690620-17690642 GACAGGAGGCAGAGCTCAGGTGG - Intronic
951226592 3:20127914-20127936 GACAGGAGGCAGAGCTCAGGCGG + Intronic
951535677 3:23738376-23738398 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
951944194 3:28115519-28115541 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
952248683 3:31627213-31627235 GATAGGAGGCGGAGCTCAGGCGG - Intronic
952285603 3:31965292-31965314 CCCAGGAGGCAGAGCTTGCAGGG + Intronic
952442445 3:33345864-33345886 TGTAGGAAGCAGTGCTTAGAGGG + Intronic
952474333 3:33691053-33691075 GACAGGAGGCAGAGCTCAGGTGG + Intronic
953162447 3:40433775-40433797 GACAGGAGGCGGAGCTCAGATGG + Intergenic
953244592 3:41179070-41179092 CACAGGGGTCTGAGCTTAGAAGG - Intergenic
953706982 3:45238580-45238602 GATAGGAGGCAGAGCTCAGGTGG - Intergenic
954231028 3:49217870-49217892 GACAGAAGGCAGAGCTCAGATGG + Intronic
954504250 3:51053495-51053517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
954513159 3:51145987-51146009 GACAGGAGGCAGAGCTCAGGTGG + Intronic
954941155 3:54374439-54374461 CGTAGAAGACACAGCTTAGATGG + Intronic
955045643 3:55357410-55357432 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
955733146 3:62008834-62008856 GACAGGAGGCAGAGCTCAGGTGG + Intronic
956153141 3:66264494-66264516 GACAGGAGGCAGAGCTCAGGTGG - Intronic
956277780 3:67521693-67521715 CATGGGAGGCAGAGGTTGCAGGG - Intronic
956647852 3:71474559-71474581 GACAGGAGGCAGAGCTCAGGTGG - Intronic
956695197 3:71912839-71912861 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
956877528 3:73478299-73478321 GACAGGAGACAGAGCTTAGGTGG - Intronic
956959081 3:74376377-74376399 GACAGGAGGCAGAGCTCAGGAGG - Intronic
957150937 3:76485376-76485398 GACAGGAGGCAGAGCTCAGGTGG + Intronic
957377081 3:79372063-79372085 GACAGGAGGCAGAGCTCAGTGGG + Intronic
957384587 3:79479405-79479427 GACAGGAGGCAGAGCTCAGGCGG + Intronic
957503629 3:81091184-81091206 GATAGGAAGCAGAGCTCAGGTGG + Intergenic
957507049 3:81135598-81135620 CACAGGAGGCAGAGATTGCAGGG - Intergenic
957584920 3:82121005-82121027 GATAGGAGGCAGAGCTCAGGCGG + Intergenic
958809295 3:98841152-98841174 CAGAGCAGGCAGATCTCAGATGG + Intronic
958841245 3:99208594-99208616 CCTGGGAGGCGGAGCTTACAGGG - Intergenic
959040855 3:101422070-101422092 GACAGGAGGCAGAGCTCAGGCGG - Intronic
959106561 3:102071468-102071490 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
959260597 3:104074776-104074798 GATAGGAGGCAGAGCTCAGGTGG + Intergenic
959386472 3:105714593-105714615 GAGAGGAGGCAGAGCTCAGGCGG + Intronic
959472441 3:106768409-106768431 CCTAGGAGGCAGAGGTTGCAGGG + Intergenic
959550471 3:107650225-107650247 GACAGGAGGCAGAGCTCAGGTGG - Intronic
959850672 3:111082991-111083013 GATAGCAGGCAGAGCTCAGGTGG + Intronic
960180425 3:114569280-114569302 CATAGGAGCCAGTGGATAGATGG + Intronic
960264026 3:115599577-115599599 GACAGGAGGCAGAGCTGAGGTGG - Intergenic
960364322 3:116752495-116752517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
960775420 3:121246136-121246158 AACAGGAGGCAGAGCTCAGGTGG - Intronic
960828605 3:121819365-121819387 GACAGGAGGCAGAGCTCAGGCGG + Intronic
960960219 3:123065525-123065547 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
961031792 3:123611900-123611922 GACAGGAGGCAGAGCTCAGGCGG + Intronic
961204670 3:125072440-125072462 CACAGGAGACAGAGCTCTGAAGG + Intergenic
961246018 3:125454288-125454310 GACAGGAGGCAGAGCTCAGGTGG - Intronic
962002122 3:131309007-131309029 GACAGGAGGCAGAGCTCAGGTGG + Intronic
962332212 3:134488120-134488142 GACAGGAGGCAGAGCTCAGGTGG - Intronic
962536890 3:136337147-136337169 CATAGAAGTCTGTGCTTAGAGGG - Exonic
963676391 3:148316699-148316721 AACAGGAGGCAGAGCTCAGGTGG + Intergenic
963961170 3:151310822-151310844 CATTGGAAGGAGAGCTTAGTTGG + Intronic
963961464 3:151313766-151313788 CCCAGGAGGCAGAGGTTACATGG + Intronic
964454107 3:156841943-156841965 GACAGGAGGCAGAGCTCAGACGG - Intronic
964613923 3:158642446-158642468 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
964737457 3:159931316-159931338 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
964745894 3:160012013-160012035 CTCAGGAGGCTGAGATTAGAAGG + Intergenic
965151487 3:164982763-164982785 CATAGGAGGCTGAGGCTAGAGGG - Intronic
965769590 3:172167723-172167745 GACAGGAGGCAGAGCTCAGGTGG - Intronic
967250912 3:187537025-187537047 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
968693906 4:2011290-2011312 CCCAGGAGGCAGAGGTTGGAGGG + Intronic
968979065 4:3836992-3837014 CACAGGAGGCAGAGCCTGGGGGG - Intergenic
969144261 4:5107094-5107116 GACAGGAGGCAGAGCTCAGGTGG - Intronic
969447049 4:7251238-7251260 GAAAAGAGGCAGAGCTCAGAAGG - Intronic
970251017 4:14116196-14116218 GACAGGAGGCAGAGCTCAGGGGG - Intergenic
971330102 4:25674922-25674944 CATAGGAGGCAGTGAGGAGATGG - Intronic
971384896 4:26133572-26133594 GATGGGAGGCAGAGCTCAGGTGG - Intergenic
971863361 4:32137894-32137916 GAAAGGAGGCGGAGCTCAGATGG - Intergenic
971909804 4:32781103-32781125 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
971917393 4:32890659-32890681 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
972494985 4:39626052-39626074 GATAGAAGGCAGAGCTCAGGTGG - Intronic
972520260 4:39847931-39847953 GACAGGAGGCAGAGCTCAGGTGG - Intronic
973265341 4:48204784-48204806 GAAAGGAGGCAGAGCTCAGTGGG + Intronic
973595658 4:52486523-52486545 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
973651454 4:53000813-53000835 GACAGGAGGCAGAGCTCAGGCGG + Intronic
973723799 4:53751993-53752015 GAAAGGAGGTAGAGCTTAGGTGG + Intronic
974335828 4:60543163-60543185 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
974505496 4:62765246-62765268 CAAAGCAGGCAGGGCTGAGAAGG + Intergenic
974610974 4:64214877-64214899 CTTGGGAGGCTGAGTTTAGAGGG + Intergenic
975301412 4:72795515-72795537 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
975417220 4:74118819-74118841 GACAGGAGGCAGAGCTCAGGAGG - Intronic
975733179 4:77357202-77357224 GATAGGAGGAAAAGCCTAGAAGG + Intronic
975857706 4:78642131-78642153 GATGGGAGGCAGAGCTCAGGCGG + Intergenic
975882645 4:78929008-78929030 GACAGGAGGCAGAGCTCAGGTGG + Intronic
975888335 4:78992901-78992923 GATAGGAGGCACAGCCTGGATGG + Intergenic
976566869 4:86561186-86561208 GACAGGAGGCAGAGCTCAGGTGG + Intronic
976576049 4:86673088-86673110 GACAGGAGGCAGAGCTCAGGTGG + Intronic
976668146 4:87622418-87622440 GACAGGAGGCAGAGCTCAGCCGG + Intergenic
977049093 4:92104181-92104203 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
977229423 4:94434159-94434181 GAAAGGAGGCGGAGCTCAGATGG - Intergenic
977638721 4:99330972-99330994 CCCAGGAGGCAGAGGTTACAGGG - Intergenic
978055832 4:104264898-104264920 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
978495122 4:109350934-109350956 AATAAGAAGCAGATCTTAGAGGG - Intergenic
978593718 4:110354482-110354504 CCTGGGAAGCAGAGCTGAGAGGG - Intergenic
979168865 4:117573496-117573518 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
979230753 4:118346712-118346734 CTTAGGAGGCAGAGCTCAGGTGG - Intronic
979230755 4:118346726-118346748 GATAGGAGGCAGAGCTTAGGAGG - Intronic
979275310 4:118809047-118809069 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
979566282 4:122157569-122157591 GACAGGAGGCAGAGCTCAGGTGG + Intronic
979972542 4:127154842-127154864 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
979977777 4:127218323-127218345 GACAAGAGGCAGAGCTTAGGTGG - Intergenic
980174429 4:129327303-129327325 CAAAGGGGGAAGAGCTCAGAAGG - Intergenic
980270599 4:130579151-130579173 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
980711370 4:136572988-136573010 GACAGGAGGCAGAGCTCAGGAGG - Intergenic
981000120 4:139821315-139821337 GACAGGAGGCGGAGCTTAGGGGG - Intronic
981200722 4:141976199-141976221 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
981269048 4:142822453-142822475 GACAGGAGGCAGAGCTCAGGTGG - Intronic
981618007 4:146663283-146663305 CATAGGAGGAGGAGCCAAGATGG + Intergenic
981961971 4:150552111-150552133 GACAGGAGGCAGAGCTCAGGTGG + Intronic
982073098 4:151713006-151713028 GACAGGAGGCGGAGCTCAGATGG - Intronic
982229214 4:153193205-153193227 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
982782659 4:159507270-159507292 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
983420450 4:167508957-167508979 GACAGGAGGCAGAGCTTAGGTGG - Intergenic
983674800 4:170280101-170280123 CATAGGACCCAGGGCTTAGAAGG - Intergenic
983869044 4:172803283-172803305 GACAGGAGGCAGAGCTCAGGTGG - Intronic
986172795 5:5327357-5327379 CTCAGGGTGCAGAGCTTAGATGG + Intergenic
986293360 5:6417893-6417915 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
986373468 5:7105536-7105558 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
986743748 5:10726533-10726555 CAGAGGAGGCAGAGGTGTGACGG + Intronic
987017863 5:13838411-13838433 GACAGGAGGCAGAGCTCAGGCGG - Intronic
987184931 5:15407631-15407653 AACAGGAGGCAGAGCTCAGATGG + Intergenic
987271040 5:16309423-16309445 GATAGGAGGCAGAGCTCAGGCGG + Intergenic
987417433 5:17678166-17678188 CATAGGAGCCAGACCTTTGTTGG - Intergenic
987583119 5:19821127-19821149 CATAGGATTCAGAGTTTGGATGG + Intronic
987742628 5:21929504-21929526 GACAGGAGGCAGAGCTCAGGTGG + Intronic
988010078 5:25470611-25470633 CTGATGAGGCAGAGCTCAGATGG - Intergenic
988122994 5:26992165-26992187 CACAAGAGGCAGAGCTCAGGTGG + Intronic
988540709 5:32106315-32106337 GACAGGAGGCAGAGCTCAGGTGG + Intronic
988705116 5:33718395-33718417 GATAGGAGGCAGAGCTCAGATGG - Intronic
988796113 5:34655370-34655392 CAAAGGAGGCAGAGCTAACGAGG + Intergenic
989799079 5:45513575-45513597 AACAGGAGGCAGAGCTCAGGTGG - Intronic
990015932 5:51063287-51063309 GATAGGAGGCAGGGCCAAGAGGG + Intergenic
990937309 5:61164112-61164134 GACAGGAGGCGGAACTTAGACGG - Intergenic
990972164 5:61519976-61519998 GACAGGAGGCAGAACTTAGATGG + Intronic
991097990 5:62759599-62759621 GACAGGAGGCAGAGTTCAGACGG - Intergenic
991575535 5:68099519-68099541 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
991625524 5:68596865-68596887 GATAGGAGGTGGAGCTCAGATGG + Intergenic
991948530 5:71925584-71925606 TATTGGAGGCAAAGCTTAGAAGG + Intergenic
992035692 5:72773383-72773405 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
992307768 5:75461233-75461255 GACAGGAGGCAGAGCTCAGGTGG - Intronic
992307871 5:75462457-75462479 GACAGGAGGCAGAGCTCAGGAGG + Intronic
992604987 5:78446998-78447020 GACAGGAGGCAGAGCTCAGGTGG - Intronic
992988033 5:82253683-82253705 GATAGGAGGAAGAGCTCAGGTGG - Intronic
993004125 5:82412587-82412609 CTTAGAAGGGAGAGCTTAAAGGG + Intergenic
993211700 5:84961106-84961128 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
993558136 5:89367349-89367371 GATAGGAGGTAGAGCTCAGTTGG + Intergenic
993859991 5:93124454-93124476 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
994480004 5:100322638-100322660 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
994516770 5:100782241-100782263 GACAGGAGGCAGAGCCCAGATGG - Intergenic
994690958 5:103018985-103019007 GACAGGAGGCAGAGCTCAGGTGG + Intronic
994972694 5:106761821-106761843 GATAGGAGGTGGAGCTTAGGCGG + Intergenic
995662396 5:114499805-114499827 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
995709595 5:115021461-115021483 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
996529080 5:124508728-124508750 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
996871171 5:128194710-128194732 CATAAGAGGAGGGGCTTAGAAGG + Intergenic
996962218 5:129264661-129264683 GAAAGGAGGCAGAGCTCAGGTGG - Intergenic
997098146 5:130937241-130937263 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
997141518 5:131386273-131386295 GACAGGAGGCAGAGCTCAGGCGG + Intronic
997243254 5:132324082-132324104 CTTAGGAGGCAGAGGTGGGAGGG + Intronic
997281147 5:132646755-132646777 GATAGGAGGTAGAGCTCAGGCGG + Intergenic
997318211 5:132955423-132955445 GATAGGAAGCAAAGCTCAGACGG + Intronic
997498961 5:134356275-134356297 GATAGGAGGCAGAGCTCAGGTGG + Intronic
997811509 5:136974919-136974941 GACAGGAGGTAGAGCTCAGACGG + Intergenic
998765551 5:145482912-145482934 GACAGGAGGCAGAGCTCAGGCGG + Intronic
999571506 5:152924984-152925006 GACAGGAGGCAGAGCTCAGCTGG - Intergenic
999587243 5:153103529-153103551 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
999883576 5:155894600-155894622 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1000771328 5:165358387-165358409 GAGAGGAGGCAGAGCTCAGGTGG + Intergenic
1001295394 5:170495454-170495476 CAGAGGTGGCAGGCCTTAGAGGG + Intronic
1001465854 5:171965448-171965470 CCCAGGAGGCAGAGGTTACAGGG + Intronic
1001468123 5:171986957-171986979 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1001733928 5:173982805-173982827 CACAGGAGGCAGGGGTTGGAGGG + Intronic
1002993150 6:2256478-2256500 CATAGGAGGCACAGCTCATTGGG + Intergenic
1003076417 6:2987327-2987349 GATAGGAGGCAGAGCTCTGGTGG + Intergenic
1003141750 6:3477655-3477677 CACAGGAGGCGGAGCTCAGGTGG + Intergenic
1003277789 6:4667096-4667118 GATAGGAGGTGGAGCTTAGGCGG - Intergenic
1003394618 6:5742485-5742507 CATTGAAGTCAGGGCTTAGAAGG - Intronic
1003486468 6:6584464-6584486 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1003850774 6:10220374-10220396 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1003948475 6:11096343-11096365 GACAGGAGGCGGAGCTCAGATGG + Intronic
1004019568 6:11764705-11764727 CATAGGAGGCACAGCTAGGATGG - Intronic
1004549701 6:16635081-16635103 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1004929324 6:20446639-20446661 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1006507546 6:34499268-34499290 GACAGGAGGCAGAGCTTAGGCGG + Intronic
1006725979 6:36199187-36199209 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1007182561 6:39940768-39940790 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
1007646314 6:43384322-43384344 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1008606989 6:53150148-53150170 CTTAGGAGGCAGAGATGAGAAGG + Intergenic
1008824973 6:55683077-55683099 CTAAGGAGGCAGAGCTTAGGTGG - Intergenic
1008908487 6:56707070-56707092 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1009649212 6:66451637-66451659 TATTGGAGGCAGAGCCTAGTGGG + Intergenic
1010003279 6:70969476-70969498 CAGAGTAGGCAGAACTAAGAAGG + Intergenic
1011256654 6:85428815-85428837 CATTGAAGGCAGTGTTTAGAGGG + Intergenic
1011429754 6:87272918-87272940 GATAGGAGGAAGAGCTGAGTAGG + Intergenic
1011802735 6:91036232-91036254 CATATTATGTAGAGCTTAGAAGG + Intergenic
1012152204 6:95768802-95768824 GAAAGGAGGCAGAGCTCAGGTGG - Intergenic
1012554003 6:100490277-100490299 GACAGGAGGCGGAGCTCAGATGG - Intergenic
1013586518 6:111583458-111583480 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1013740696 6:113280479-113280501 GACAGGAGGCAGAGCTCAGGAGG + Intergenic
1013746024 6:113347526-113347548 CATAAGAAGCAGAGCCAAGAGGG - Intergenic
1014227327 6:118862629-118862651 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1014460439 6:121688256-121688278 GACAGGAGGCGGAGCTTAGGTGG + Intergenic
1014474663 6:121857757-121857779 GACAGGAGGCGGAGCTCAGATGG - Intergenic
1014727375 6:124988050-124988072 GATAGGAGGCGGAGCTCAGGTGG - Intronic
1014747536 6:125217526-125217548 GATGGGAGGCAGAGCTCAGGTGG + Intronic
1014879361 6:126703757-126703779 CCTAGGAGTCAGAGCTTAGTTGG - Intergenic
1014968454 6:127784716-127784738 CAGATGAGGTAGAGCTGAGATGG + Intronic
1015001276 6:128219478-128219500 GATAGGAGGCAGAGCTCAGGTGG + Intronic
1015066797 6:129039823-129039845 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1015094851 6:129403018-129403040 CATAGGAGGGAGAGTAAAGAGGG + Intronic
1015672731 6:135708699-135708721 AACAGGAGGCAGAGCTCAGGCGG + Intergenic
1015725444 6:136294813-136294835 GACAGGAGGAAGAGCTCAGATGG - Intergenic
1016203207 6:141438990-141439012 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1016462836 6:144296225-144296247 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1016471985 6:144384299-144384321 GACAGGAGGCAGAGCTCAGGAGG - Intronic
1016518015 6:144918334-144918356 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1016610581 6:145984477-145984499 TATAGGAGTAAGAGCTTAAATGG + Intergenic
1016666920 6:146653034-146653056 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1016921828 6:149302941-149302963 GACAGGAGGCAGAGCTCAGGAGG - Intronic
1018577779 6:165277334-165277356 CCTAGGCTGCAGAGCTTTGATGG + Intergenic
1018826472 6:167411061-167411083 TATAGGAGGCAGACATTATATGG + Intergenic
1019315549 7:382773-382795 GGTATGAAGCAGAGCTTAGAGGG + Intergenic
1019389335 7:776908-776930 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1019629660 7:2041694-2041716 CAGATGAGGAAGAGCTTTGAAGG + Intronic
1019802549 7:3098939-3098961 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1019935185 7:4250417-4250439 CCCAGGAGGCGGAGGTTAGAGGG - Intronic
1020381895 7:7556709-7556731 CAGCTGAGGCAGAGCCTAGACGG + Intergenic
1020598789 7:10247293-10247315 GACAGGAGCCAGAGCTTAGGCGG - Intergenic
1020780235 7:12508755-12508777 GACAGGAAGCAGAGCTCAGATGG - Intergenic
1020826496 7:13035608-13035630 GACAGGAGGCAGAGCTCAGATGG - Intergenic
1020859511 7:13473371-13473393 GTTAGGAGGCAGAGCTTGGTTGG - Intergenic
1021021168 7:15600113-15600135 CATGGGAGGGAGGGCTGAGAGGG - Intergenic
1021055542 7:16042402-16042424 GATAGGAGGCAGAACTCAGGTGG + Intergenic
1021548156 7:21839497-21839519 CCCAGGAGGCAGAGCTTTCAGGG + Intronic
1021554370 7:21904511-21904533 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1021652615 7:22846508-22846530 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1022584428 7:31592684-31592706 GACAGGAGGCAGAGCTTAGGTGG + Intronic
1022683533 7:32572724-32572746 CCCAGGAGGCAGAGCTTGCAGGG + Intronic
1022958076 7:35399543-35399565 CATTGGAGGCAGAGCTGGGATGG + Intergenic
1022975644 7:35553517-35553539 CATAAGAGGCAGAACTGAGAAGG - Intergenic
1023090114 7:36609427-36609449 CATGGGAGGCAGATCTCAAAGGG - Intronic
1023116473 7:36867654-36867676 CAGTGAAGGCAGTGCTTAGAGGG - Intronic
1023327016 7:39071314-39071336 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1023640424 7:42251395-42251417 GACAGGAGGCAGAGCTTAGGCGG + Intergenic
1024744744 7:52393037-52393059 AACAGGATGCAGAGATTAGAAGG + Intergenic
1024789671 7:52950046-52950068 CAGTGAAGGCAGAACTTAGAGGG + Intergenic
1024962649 7:54993955-54993977 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1025123965 7:56330114-56330136 CCCAGGAGGCGGAGCTTGGAGGG - Intergenic
1026177596 7:68011605-68011627 CTTAGCAGGCAGAGCTAGGAAGG + Intergenic
1026182370 7:68053127-68053149 AACAGGAGGCAGAGCTCAGAGGG + Intergenic
1026310116 7:69175958-69175980 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1026574726 7:71562618-71562640 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1026647781 7:72187444-72187466 TACAGGAGGCAGAGCTCAGGAGG - Intronic
1026668988 7:72370576-72370598 CCCGGGAGGCGGAGCTTAGAAGG + Intronic
1027403238 7:77830481-77830503 GACAGGAGGCAGAGCTCAGATGG - Intronic
1028283180 7:88959568-88959590 TATCAGAGGAAGAGCTTAGAAGG - Intronic
1028563710 7:92204696-92204718 GACAGGAGGCAGAGCTCAGATGG + Intronic
1028653778 7:93179047-93179069 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1029151018 7:98480543-98480565 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1029431779 7:100535893-100535915 GAGAGGAGGCAGAGCTCAGGCGG + Intergenic
1029512847 7:101007431-101007453 TAATGGAGGCAGAGCGTAGAAGG - Intronic
1030049512 7:105525200-105525222 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1031634269 7:124082977-124082999 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1031731449 7:125306799-125306821 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1031759367 7:125692428-125692450 GAGAGGAGGCAGAGCTCAGGTGG - Intergenic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032224814 7:130022856-130022878 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1032354744 7:131200073-131200095 CAGAGGTTGCAGAGCTGAGATGG - Intronic
1032409431 7:131683704-131683726 CATAGGAGCCAGACCCCAGAGGG - Intergenic
1032438228 7:131920030-131920052 GACAGGAGGCAGAGCTTGGGAGG + Intergenic
1032587835 7:133163997-133164019 GATGGGAGGCAGAGCTCAGGTGG + Intergenic
1032762148 7:134953398-134953420 CCTGGGAGGCAGAGGTTAGCTGG + Intronic
1032847995 7:135768294-135768316 CATGGAAGGCAGAGCTTAAAGGG + Intergenic
1033684797 7:143628549-143628571 AACAGGAGGCGGAGCTTAGGTGG - Intronic
1033687972 7:143707768-143707790 AACAGGAGGCGGAGCTTAGGTGG - Intronic
1033699815 7:143829072-143829094 AACAGGAGGCAGAGCTTAGGTGG + Intergenic
1033963698 7:146947105-146947127 CATGGGAGGCAGAAGTTACAGGG - Intronic
1033974574 7:147085357-147085379 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1034502390 7:151459205-151459227 GACAGGAGGCAGAGCTCAGCTGG - Intergenic
1034905419 7:154940477-154940499 GATACGAGGCAGAGCTCAGGCGG - Intronic
1035347859 7:158217630-158217652 CATAGGATTCAGAGTCTAGATGG + Intronic
1035812989 8:2507829-2507851 AACAGGAGGCAGAGCTCAGGTGG - Intergenic
1036966292 8:13301754-13301776 CACAAGAGCCAGAGCTCAGACGG - Intronic
1037259675 8:16993887-16993909 CACAGGAGGCGGAGCTTAGGTGG + Intronic
1037311881 8:17564678-17564700 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1037530103 8:19764760-19764782 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1037690359 8:21176705-21176727 CACAGGAGGCGGAGCTCAGGCGG + Intergenic
1038032991 8:23661253-23661275 GACAGGAGGCGGAGCTCAGATGG + Intergenic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038675993 8:29623449-29623471 GACAGGAGGTAGAGCTTAGGCGG + Intergenic
1039037344 8:33374078-33374100 GACAGGAGGCAGAGCTCAGACGG - Intronic
1039042005 8:33417085-33417107 GACAGGAGGCGGAGCTCAGACGG - Intronic
1039250894 8:35662866-35662888 CACAGGAGGCAGAGCTCAGGTGG - Intronic
1039364689 8:36917456-36917478 CCTAGGAGGCTGAGGTGAGAGGG - Intronic
1040408205 8:47129886-47129908 GACAGGAGGCGGAGCTTAGGTGG - Intergenic
1040782966 8:51132439-51132461 CTTAGGAGGCTGAGATGAGAAGG + Intergenic
1041040978 8:53845337-53845359 GACAGGAGGCAGAGTTTAGGCGG - Intergenic
1041212995 8:55571580-55571602 GATAGGAGGCAGAGCTCAGGTGG - Intergenic
1042068742 8:64907115-64907137 GATAGGAGGCGGAGCTCAGGTGG + Intergenic
1042273137 8:66976071-66976093 GATAGGAGGCAGAGCTCAGGTGG - Intronic
1042398428 8:68317619-68317641 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1042406195 8:68408096-68408118 GACAGGAGGCAGAGCTCAGGAGG - Intronic
1042484911 8:69338297-69338319 CACAGGAGGGAGAGCTCAGTGGG + Intergenic
1043001036 8:74759722-74759744 CATAGGATGCTGAGCTTTGAAGG - Intronic
1043417914 8:80070589-80070611 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1043510882 8:80949143-80949165 GATAGGAGGCAAAGCTGAGGTGG - Intergenic
1043536482 8:81210507-81210529 GACAGGAGGCAGAGCTTAGGCGG + Intergenic
1043697756 8:83242280-83242302 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1043781317 8:84339356-84339378 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1043783155 8:84362506-84362528 CACACGAGGCAGAGCTCAGTGGG - Intronic
1044416452 8:91945499-91945521 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1044539743 8:93395248-93395270 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1044875016 8:96656863-96656885 GAAAGGAGGCAGAGCTCACAGGG - Intronic
1045001937 8:97885992-97886014 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1045130791 8:99149770-99149792 CACAGGAGGCGGAGCTCAGGTGG - Intronic
1045413270 8:101941376-101941398 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1045451879 8:102334820-102334842 CCCAGGAGGCAGAGCTTGCAAGG + Intronic
1045601479 8:103722568-103722590 GACAGGAGGCAGAGCTCAGATGG + Intronic
1046114602 8:109769596-109769618 CCTAGGAGTCAGAGGTTAGAAGG - Intergenic
1046349304 8:112985673-112985695 GATAGGTGGCAGAGCTCAGTAGG - Intronic
1046526706 8:115390015-115390037 GACAGGAGGCAGCGCTAAGAAGG + Intergenic
1046759834 8:118009640-118009662 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1046928327 8:119817303-119817325 GACAGGAGGCAAAGCTCAGAAGG - Intronic
1046998800 8:120552996-120553018 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1047177258 8:122553623-122553645 GACAGGAGGCAGAGCTCAGACGG + Intergenic
1047188540 8:122657346-122657368 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1047777530 8:128085445-128085467 CATAGGAGGAAGAGTTAAGGTGG - Intergenic
1048066095 8:130970281-130970303 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1048071804 8:131029070-131029092 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1048607215 8:135982116-135982138 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1048741817 8:137569104-137569126 CATAGGAGGCAAACATTACATGG + Intergenic
1048938157 8:139374195-139374217 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1049132734 8:140862664-140862686 GACAGGAGGCAGAGCTCAGGCGG - Intronic
1049194360 8:141307648-141307670 GATAGCAGGCAGGGGTTAGAAGG + Intronic
1049537987 8:143191229-143191251 CACAGGAGGCAGAGGTTGCAGGG + Intergenic
1049550215 8:143254037-143254059 GACAGGAGGCGGAGCTTAGGCGG + Intronic
1050131263 9:2415141-2415163 TACAGGAGGCAGAGCTCAGGTGG + Intergenic
1050161747 9:2726792-2726814 GACAGGAGGCAGAACTTAGGCGG - Intronic
1050486907 9:6143896-6143918 GATGGGAGGCAGAGCTCAGGCGG + Intergenic
1051286422 9:15501982-15502004 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1051347791 9:16168224-16168246 CATTAGGGACAGAGCTTAGATGG + Intergenic
1051884137 9:21872203-21872225 CTCAGGAGGCTGAGCTTAGCAGG + Intronic
1052309123 9:27045149-27045171 AACAGGAGGCAGAGCTCAGACGG - Intronic
1053221778 9:36318594-36318616 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
1053630115 9:39928769-39928791 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1053775657 9:41534763-41534785 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1054213772 9:62321933-62321955 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1054352828 9:64033014-64033036 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
1055196194 9:73597134-73597156 CATAGAATGCAGAGCTCAGGAGG + Intergenic
1055542400 9:77325226-77325248 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1055657289 9:78463910-78463932 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1056521640 9:87407545-87407567 CCCAGGAGGCAGAGCTTGCAGGG - Intergenic
1056557393 9:87701103-87701125 AATAGGAGGAAAAGCTTAGAGGG + Intronic
1056651549 9:88469247-88469269 GACAGGAGGCAGAGCTCAGACGG + Intronic
1057062781 9:92020343-92020365 AACAGGAGGCAGAGCTCAGGTGG - Intergenic
1057307192 9:93919305-93919327 CACATGAGGCAGAGGTGAGAAGG - Intergenic
1057326311 9:94067675-94067697 CTTGGGAGGCAGAGGTTACAGGG - Intronic
1057632452 9:96731536-96731558 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1057804090 9:98208503-98208525 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1058131094 9:101254403-101254425 GACAGGAGGCAGAGCTCAGGTGG + Intronic
1058484196 9:105427009-105427031 CCTAGGAGGCGGAGGTTGGAGGG - Intronic
1058745205 9:107983733-107983755 CATAGGAGGGAGGTCTAAGAAGG - Intergenic
1058999308 9:110331800-110331822 AACAGGAGGCAGAGCTCAGGAGG + Intronic
1059017282 9:110533102-110533124 GACAGGAGGCAGAGCTCAGGCGG + Intronic
1059800642 9:117746340-117746362 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1059822776 9:117992379-117992401 GAGAGGAGGCAGGGGTTAGAGGG + Intergenic
1059938787 9:119337766-119337788 TAGAAGAGGCAGAGCTTAGGTGG - Intronic
1060105429 9:120870008-120870030 CAAAGGAGGCAGGGCTGGGAGGG + Intronic
1060126109 9:121048347-121048369 GACAGGAGGCAGAGCTCAGGTGG - Intronic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060643273 9:125257144-125257166 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1061391093 9:130317568-130317590 CCCAGGAGGCAGAGGTTGGAGGG - Intronic
1061505506 9:131029643-131029665 CAGAGGACACAGAGCTTGGAAGG + Intronic
1061524427 9:131146852-131146874 CCTAGGAGGCAGAGATTGCAGGG + Intronic
1062006569 9:134241274-134241296 CACAGGAGGCAGAGGTTGCAGGG + Intergenic
1185728174 X:2439799-2439821 CATAGGAGGCAGAGCTCAGGAGG + Intronic
1185742386 X:2544256-2544278 GACGGGAGGCAGAGCTCAGATGG - Intergenic
1185930902 X:4202442-4202464 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1186787556 X:12967925-12967947 CACAGGAGGCATAGCTCAGGCGG - Intergenic
1187014163 X:15309258-15309280 GACAGGAGGCAGAGCTCAGGAGG - Intronic
1187328791 X:18316781-18316803 GATAGGAGACAGAGCTGAGGTGG - Intronic
1188949021 X:36345476-36345498 AACAGGAGGCAGAGCTCAGGTGG + Intronic
1189384907 X:40529293-40529315 GACAGGAGGCAGAGCTCAGACGG - Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189641928 X:43081977-43081999 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1190261022 X:48796915-48796937 GACAGGAGGCGGAGCTTAGGTGG - Intergenic
1190272409 X:48876255-48876277 CTTGGGAGGCTGAGCTTAGGAGG + Intergenic
1190919104 X:54834001-54834023 CCCAGGAGGCAGAGGTTACAGGG - Intergenic
1191039809 X:56067428-56067450 CATGAGAGGCAGTGCCTAGATGG + Intergenic
1192156287 X:68748989-68749011 GACAAGAGGCAGAGCTTAGTCGG - Intergenic
1192256730 X:69467559-69467581 CTTAGGAGGTAGGGCTTAGTGGG + Intergenic
1192410511 X:70929164-70929186 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1192794784 X:74418013-74418035 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1193037288 X:76965880-76965902 GACATGAGGCAGAGCTCAGATGG + Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1193859193 X:86642946-86642968 CATAGAAGGCAGTGTTAAGAGGG + Intronic
1193911016 X:87306604-87306626 GACAGGAGGCGGAGCTTAGGCGG - Intergenic
1194786251 X:98087494-98087516 CACAGGATGCAGAGCTCAGGTGG + Intergenic
1194852625 X:98888353-98888375 CCCAGGAGGCAGAGCTTGCAAGG - Intergenic
1195341926 X:103914927-103914949 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1196329735 X:114457750-114457772 GAAAGGAGGCAGAGCTCAGGTGG + Intergenic
1196696938 X:118623334-118623356 CCTAGGAGGTAGAACTTAGGAGG + Intronic
1196872322 X:120124820-120124842 AACAGGAGGCAGAGCTCAGGCGG + Intergenic
1197075378 X:122346302-122346324 GATAGGAGGCAGAGCTCAGGTGG + Intergenic
1197276646 X:124487402-124487424 CTTAGGAGGCAAAGCCTGGAGGG - Intronic
1197549623 X:127873884-127873906 CACAGGAGGCAGCGCTCAGGCGG + Intergenic
1197808815 X:130422980-130423002 CACAGGAGGCAGAGCTCAGGTGG - Intergenic
1197982151 X:132228349-132228371 GATAGGAGGCAGAGCTCAGGCGG - Intergenic
1198188781 X:134282941-134282963 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1198271276 X:135058594-135058616 GACAGGAGGCAGAGCTCAGGTGG - Intergenic
1198553643 X:137769927-137769949 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1198558723 X:137825034-137825056 GACAGGAGGCAGAGCTCAGACGG + Intergenic
1198828304 X:140721549-140721571 GACAGGAGGCAGAGCTCAGGTGG + Intergenic
1198854267 X:140999881-140999903 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
1199225573 X:145369227-145369249 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1200254207 X:154570841-154570863 GACAGGAGGCAGAGCTCAGGCGG + Intergenic
1200263562 X:154633567-154633589 GACAGGAGGCAGAGCTCAGGCGG - Intergenic
1200304109 X:155007614-155007636 CACAGGAGGCAGAGCCCAGGCGG - Intronic
1200743915 Y:6885397-6885419 CCCAGGAGGCAGAGCTTGCAGGG + Intergenic
1200896952 Y:8385797-8385819 CCAAGGAGGCAGAGCTTTCAGGG + Intergenic
1202245072 Y:22811745-22811767 CCCAGGAGGCAGAGCTTGCAGGG - Intergenic
1202398062 Y:24445491-24445513 CCCAGGAGGCAGAGCTTGCAGGG - Intergenic
1202472719 Y:25224595-25224617 CCCAGGAGGCAGAGCTTGCAGGG + Intergenic