ID: 1087180787

View in Genome Browser
Species Human (GRCh38)
Location 11:95140437-95140459
Sequence CACTGACATCAGCTGCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087180779_1087180787 30 Left 1087180779 11:95140384-95140406 CCAGGCAGACATCTCCTAATAAC No data
Right 1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG No data
1087180786_1087180787 -6 Left 1087180786 11:95140420-95140442 CCTTGGGCAGGATAAGACACTGA No data
Right 1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG No data
1087180781_1087180787 16 Left 1087180781 11:95140398-95140420 CCTAATAACACCTGTCGGTATAC No data
Right 1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG No data
1087180784_1087180787 6 Left 1087180784 11:95140408-95140430 CCTGTCGGTATACCTTGGGCAGG No data
Right 1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087180787 Original CRISPR CACTGACATCAGCTGCTTAA AGG Intergenic
No off target data available for this crispr