ID: 1087183485

View in Genome Browser
Species Human (GRCh38)
Location 11:95161497-95161519
Sequence TGCCCCTCCAGTATTTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087183485_1087183489 6 Left 1087183485 11:95161497-95161519 CCCTGCCAAATACTGGAGGGGCA No data
Right 1087183489 11:95161526-95161548 CTTGTGGCTGTCCTCTCTCTTGG No data
1087183485_1087183493 25 Left 1087183485 11:95161497-95161519 CCCTGCCAAATACTGGAGGGGCA No data
Right 1087183493 11:95161545-95161567 TTGGGTTTGCATGCCTATATGGG No data
1087183485_1087183490 7 Left 1087183485 11:95161497-95161519 CCCTGCCAAATACTGGAGGGGCA No data
Right 1087183490 11:95161527-95161549 TTGTGGCTGTCCTCTCTCTTGGG No data
1087183485_1087183488 -10 Left 1087183485 11:95161497-95161519 CCCTGCCAAATACTGGAGGGGCA No data
Right 1087183488 11:95161510-95161532 TGGAGGGGCAATTTTTCTTGTGG No data
1087183485_1087183492 24 Left 1087183485 11:95161497-95161519 CCCTGCCAAATACTGGAGGGGCA No data
Right 1087183492 11:95161544-95161566 CTTGGGTTTGCATGCCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087183485 Original CRISPR TGCCCCTCCAGTATTTGGCA GGG (reversed) Intergenic
No off target data available for this crispr