ID: 1087183956

View in Genome Browser
Species Human (GRCh38)
Location 11:95166712-95166734
Sequence ACACATACACAGTCTCAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087183956_1087183959 23 Left 1087183956 11:95166712-95166734 CCTTGCTGAGACTGTGTATGTGT 0: 1
1: 0
2: 0
3: 27
4: 355
Right 1087183959 11:95166758-95166780 AGAAGATGCCAAACTGGCTGTGG 0: 1
1: 0
2: 3
3: 21
4: 235
1087183956_1087183958 17 Left 1087183956 11:95166712-95166734 CCTTGCTGAGACTGTGTATGTGT 0: 1
1: 0
2: 0
3: 27
4: 355
Right 1087183958 11:95166752-95166774 GCACTGAGAAGATGCCAAACTGG 0: 1
1: 0
2: 1
3: 13
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087183956 Original CRISPR ACACATACACAGTCTCAGCA AGG (reversed) Exonic
900338532 1:2176774-2176796 ACACATGCACAGGCAAAGCAAGG - Intronic
901296927 1:8168043-8168065 ACACACGCAGGGTCTCAGCATGG - Intergenic
902719319 1:18293476-18293498 TCACGTCCACATTCTCAGCATGG - Intronic
903445058 1:23417561-23417583 ACAAATACACAGTCTCACATGGG + Intronic
903755684 1:25658875-25658897 ACACACACACAATCTGAGCGGGG + Intronic
904036281 1:27560882-27560904 ACACACACACCGTCTCACAAAGG - Intronic
905233335 1:36529257-36529279 ACACAGTCACAGTGCCAGCAGGG - Intergenic
905795633 1:40814798-40814820 ACACGTACCCAGAGTCAGCAAGG - Intronic
906529031 1:46512659-46512681 ACACCTACACACCCTCTGCATGG + Exonic
907576854 1:55534490-55534512 AAACCTATACAGTCACAGCAAGG + Intergenic
910290692 1:85597624-85597646 ACACACACACACACACAGCACGG + Intergenic
911006842 1:93234926-93234948 ACACACACACACTCTTAGCTGGG - Intronic
911660185 1:100492835-100492857 ACACACACACACACACAGCAGGG - Intronic
912265746 1:108155973-108155995 ACACACACACACTCACAGAACGG + Intronic
912933507 1:113983780-113983802 ACACATACGCAGTCACACTAGGG - Intergenic
913172444 1:116245036-116245058 ACACACACACAGTTTCCCCATGG + Intergenic
914411710 1:147435486-147435508 ACACACACACATTGTGAGCATGG + Intergenic
915062415 1:153197121-153197143 ACACACACACATTCTCTGCCTGG - Intergenic
915926267 1:160022230-160022252 ACACACACACAAACCCAGCATGG + Intergenic
916368908 1:164066755-164066777 ACACATACATAGTTTCAATATGG - Intergenic
917643357 1:177005694-177005716 ACACATACACATACACACCATGG - Intronic
917757166 1:178113463-178113485 ACACATACACAAAATCAGCCTGG - Intronic
917940255 1:179912433-179912455 ACACAAACACATACACAGCAGGG - Intronic
918364381 1:183790934-183790956 ACACACACACAATCTCTGGAGGG + Intronic
919719381 1:200815671-200815693 ACATATATACAGTCTCATAAAGG - Intronic
921628290 1:217402665-217402687 ACACACATACAGTGGCAGCAAGG - Intergenic
922546560 1:226462259-226462281 CCAAAATCACAGTCTCAGCAGGG - Intergenic
924561241 1:245157176-245157198 ACACACACACAGACTGAGAAGGG - Intronic
924631011 1:245740901-245740923 ACACAGGCACACACTCAGCAAGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063599952 10:7471895-7471917 ACACATACACACATACAGCATGG + Intergenic
1066528447 10:36308530-36308552 ACAAATACACAGGCTGGGCATGG + Intergenic
1067299637 10:44996804-44996826 ACACACACGCTGTCTCAGCAGGG - Intergenic
1068220260 10:54035558-54035580 ACACATACACCATCTCATCTTGG - Intronic
1068804844 10:61183791-61183813 AAACAAAGACAGTCTCATCAGGG + Intergenic
1070375195 10:75823768-75823790 ACACATACACACACACACCATGG + Intronic
1071892928 10:90031671-90031693 ACACACACACACTCACACCAAGG + Intergenic
1072811329 10:98464469-98464491 ACACCTACACAGACGCTGCAAGG - Intronic
1073000485 10:100281734-100281756 ACACACACACACTATCAGCTAGG + Intronic
1073557989 10:104472090-104472112 ACACACACACAGCTTCACCAGGG + Intergenic
1074392485 10:113069681-113069703 CTACATACACAGTCTCTGAATGG - Intronic
1074958759 10:118419494-118419516 ACACATACCCAGACACAGGAAGG - Intergenic
1075090607 10:119442207-119442229 ACAGAGTCACAGTCTCTGCAGGG + Intronic
1076502164 10:130945720-130945742 ACAAAACCACAGTATCAGCAGGG - Intergenic
1076574115 10:131452677-131452699 ACTCATACACTGTCTCAGGATGG - Intergenic
1077312241 11:1894099-1894121 ACACACACACACTCCCAGCCCGG - Intergenic
1078500092 11:11864700-11864722 ACACATACACAGTTTCAAAAAGG - Intronic
1080089246 11:28325130-28325152 GCACCTGCACAGTGTCAGCAGGG + Intronic
1083186509 11:61020900-61020922 ACACACACACACTCTGAACATGG - Intergenic
1083592118 11:63901984-63902006 TGACAAACACAGTCTCAGAAAGG - Intronic
1084524684 11:69688604-69688626 ACCAATACCCAGCCTCAGCAAGG + Intergenic
1084524808 11:69689849-69689871 ACCAATACCCAGCCTCAGCAAGG + Intergenic
1085758533 11:79221886-79221908 AAACACACACAGCCTCACCAGGG - Intronic
1085944357 11:81248849-81248871 ACACATACACACACTCTACAAGG - Intergenic
1086401035 11:86461065-86461087 ACACCCACACTGTTTCAGCAGGG + Intronic
1086504586 11:87491788-87491810 ACACACACACAGTGATAGCATGG - Intergenic
1086877785 11:92118184-92118206 ACACACACACACACACAGCATGG + Intergenic
1087149411 11:94845192-94845214 TCACAGAAACAGTTTCAGCAGGG + Intronic
1087183956 11:95166712-95166734 ACACATACACAGTCTCAGCAAGG - Exonic
1088506252 11:110530452-110530474 ACACATACACAGGATTAGAAAGG + Intergenic
1088643068 11:111892755-111892777 ACACAGACACTGTCCCAGCAGGG - Intergenic
1089323302 11:117640884-117640906 ACACAAACACACACACAGCAGGG - Intronic
1090742941 11:129682525-129682547 TCATATTCACAGTTTCAGCAGGG + Intergenic
1091414785 12:272170-272192 ACACACACACAGAGCCAGCACGG + Intergenic
1091803141 12:3337604-3337626 ACACACACACACGTTCAGCATGG + Intergenic
1092216740 12:6688986-6689008 ACACACACACAGTCACATCGTGG + Intronic
1092807134 12:12234843-12234865 ACACATTCACATTCTGAGAACGG + Intronic
1092818874 12:12334885-12334907 ACTCAGACACAGCCTCAGCTAGG + Intronic
1093829245 12:23735853-23735875 ACAAATATAAAGTCACAGCATGG - Intronic
1094288434 12:28819030-28819052 GCACCTATACAGTGTCAGCAGGG - Intergenic
1095866034 12:46973040-46973062 ACACACACACATTCTCTGGAAGG + Intergenic
1101295061 12:103413840-103413862 ACACATACACACACACACCATGG - Intronic
1101322516 12:103685417-103685439 ACACACACACACACACAGCATGG - Intronic
1101803587 12:108043982-108044004 ACACAGCCAGACTCTCAGCATGG + Intergenic
1101811425 12:108111405-108111427 TAACACACACACTCTCAGCATGG - Intergenic
1101986904 12:109454296-109454318 AAACATAGGGAGTCTCAGCAAGG + Intronic
1102201600 12:111061200-111061222 ACACACACACACACACAGCAAGG + Intronic
1102594056 12:113978856-113978878 ACACATACAGAGAATCATCAAGG + Intergenic
1102706611 12:114886336-114886358 GCACATACATAGTCTCAGTTTGG + Intergenic
1102871200 12:116415738-116415760 ACACATACACACTCACAGACAGG - Intergenic
1104536635 12:129623628-129623650 ACACATACACACACACACCATGG - Intronic
1105013671 12:132773131-132773153 ACAGAGACACAGTCAGAGCAGGG - Exonic
1106021994 13:25924469-25924491 ACACAGACACAGACACAGGAAGG - Intronic
1106301636 13:28471573-28471595 ACACATGCATAGTCATAGCATGG + Intronic
1106793152 13:33177336-33177358 ACACACACACAGTCAAATCAAGG + Intronic
1107685061 13:42888801-42888823 CCACCTACACAGTTACAGCAAGG + Intronic
1109057864 13:57575340-57575362 ACACACACACAGACACACCATGG - Intergenic
1109278232 13:60325677-60325699 ACACATACACATTAGCAGAAAGG + Intergenic
1109306450 13:60647009-60647031 ACACCTACACATTCCCAGCCTGG + Intergenic
1109524165 13:63554038-63554060 ACACATACACAGGCTGGGCACGG - Intergenic
1113723578 13:112580126-112580148 AGACATACACAGACACAGGATGG + Intronic
1114332159 14:21648206-21648228 ACACACACACAAACTCACCAAGG + Intergenic
1115824140 14:37246574-37246596 AAACATTGACAGTCTAAGCAGGG - Intronic
1117154657 14:52926442-52926464 ACACACACACACACTCAGCCTGG + Intronic
1117271896 14:54152996-54153018 ACACACACAGAGACACAGCATGG + Intergenic
1118463610 14:66010755-66010777 GCACATGTACAGTGTCAGCAGGG + Intergenic
1119506609 14:75178482-75178504 ACACATACACAGTTTTTTCATGG - Intergenic
1119805789 14:77481473-77481495 AGACATATACAGTGCCAGCATGG - Intronic
1120714762 14:87829004-87829026 AAAGATAAAAAGTCTCAGCAAGG - Intergenic
1122033057 14:98927636-98927658 ACACATACAGAGCTCCAGCAAGG - Intergenic
1122732974 14:103815464-103815486 ACACAAACACAGGCTAGGCATGG + Intronic
1122869420 14:104629406-104629428 ACACATACTTTCTCTCAGCATGG - Intergenic
1123686544 15:22801808-22801830 ACACATAAAAAGTCACAGCCAGG - Intronic
1124269586 15:28268457-28268479 ATACATACACAGTGTCCCCATGG + Exonic
1124445275 15:29725336-29725358 AGACATACACAGCCTCTGCAAGG - Intronic
1126413523 15:48395670-48395692 ACACATACCCAGTCACTCCAAGG + Intergenic
1127868493 15:63050397-63050419 ACACATACTCTTTCTTAGCAGGG - Intronic
1129454899 15:75671460-75671482 ACCCAAACACAGCCTCAGCAGGG - Intergenic
1130073009 15:80664933-80664955 ACACACACACACACACAGCAGGG + Intergenic
1131917275 15:97282085-97282107 ACAAAGACACAGTCTCAGTGAGG - Intergenic
1132014123 15:98300825-98300847 ACACAGACACAGACACAGCTGGG - Intergenic
1132806278 16:1776517-1776539 ACACACACACACACTCGGCAGGG + Intronic
1135243493 16:20832625-20832647 ACACACACACAGACTCAAAAGGG + Intronic
1136020933 16:27439666-27439688 ACACATGCACAGACTCACAAGGG + Intronic
1138113687 16:54343762-54343784 AGACAGACAGAGTCTCAGAAGGG + Intergenic
1138972077 16:62157438-62157460 ACACAAATACATTTTCAGCATGG + Intergenic
1139003877 16:62547529-62547551 ACACACACACACACTCACCATGG - Intergenic
1139231429 16:65286258-65286280 ACACACACACACTCTCAGAGTGG + Intergenic
1142115845 16:88355732-88355754 CCACATACTCAGACCCAGCATGG + Intergenic
1142951456 17:3484491-3484513 ACACATACACAACCTCAAGATGG - Intronic
1145968593 17:28940005-28940027 AGACATACAGAGTAACAGCAGGG - Intronic
1147406152 17:40213787-40213809 CCACACACACAGGCTCAGCGGGG + Intergenic
1147466668 17:40616148-40616170 ACACAAACACAGTGTGAGGATGG + Intergenic
1148050192 17:44766327-44766349 ACAGACACACAGTCTTAGGAAGG - Intronic
1152168336 17:78725532-78725554 ACACATACACACTCTCTTCAGGG + Intronic
1153835929 18:8963776-8963798 ACACACACACAGACTCACAATGG + Intergenic
1154988716 18:21579826-21579848 ACACACACACACACACAGCAGGG + Intronic
1155319001 18:24599867-24599889 ACACATACACAGTGTATGCATGG - Intergenic
1157633347 18:49123403-49123425 ACACAGAAACAGCCTCACCATGG - Intronic
1158299676 18:56037311-56037333 ACACAAACTCACTTTCAGCAGGG - Intergenic
1159275109 18:66209089-66209111 ACACATAAACAGCATCACCATGG - Intergenic
1159391998 18:67805607-67805629 AAACGTAGACAGTTTCAGCATGG - Intergenic
1159416781 18:68160845-68160867 ACACACACAGAGTTTCTGCAAGG + Intergenic
1159609943 18:70513830-70513852 GCACATGGACAGTGTCAGCAGGG + Intergenic
1159760760 18:72422752-72422774 ACACACATACAGACTCACCAAGG + Intergenic
1160006708 18:75073699-75073721 ACACTTACAGAGCCTCAGAAAGG + Intergenic
1160486190 18:79295112-79295134 ACACACACACACACACAGCAAGG + Intronic
1160849226 19:1182094-1182116 GCACATGCAAAGTCTCAGCGGGG + Intronic
1161499386 19:4605256-4605278 ACACACACACAGTCTGAACGTGG - Intergenic
1161726023 19:5929562-5929584 ACACACACAGAGTCTCAGACTGG - Intronic
1161911497 19:7197951-7197973 ACACACACACACTCCCACCATGG - Intronic
1161911503 19:7197976-7197998 ACACACACACACTCCCACCATGG - Intronic
1162501976 19:11059320-11059342 ACACATACACAGCCTCAACTTGG + Intronic
1162594120 19:11613856-11613878 AAAGATACACAGTCTCAGGGTGG + Intronic
1162884878 19:13689469-13689491 ACTCATACACAGTCTGAGATAGG - Intergenic
1162995844 19:14334489-14334511 ACACACACACACTCTTAGCCGGG + Intergenic
1163743642 19:19032474-19032496 TCCCATTCACAGACTCAGCAGGG + Intronic
1164755552 19:30686415-30686437 ACACATACACACTCACAGGGTGG - Intronic
1165617937 19:37218531-37218553 ACACAATCACAGTCCCAACACGG - Intronic
1166387557 19:42390566-42390588 ACAGAAACACAGTGTCAGAAAGG + Intergenic
1167295682 19:48647774-48647796 ACACACACACAGACTGAGCATGG + Intergenic
1167514601 19:49915802-49915824 ACACATCCACAGTCCTGGCAGGG - Intronic
1168216971 19:54933540-54933562 ACACACACACACACCCAGCAGGG + Intronic
1168232582 19:55042628-55042650 ACACACACACAGTCTCCGGTCGG + Intronic
925481959 2:4285366-4285388 ATACAAAGACAGTATCAGCAGGG - Intergenic
926437991 2:12856960-12856982 ACACACACACACAATCAGCAAGG - Intergenic
926550151 2:14291586-14291608 ACACTAACACAGTCCCAACATGG + Intergenic
926939872 2:18124170-18124192 ACACAGACACACTCTCAGTATGG - Intronic
929307442 2:40379656-40379678 AAACAGACACATTCTCTGCAGGG - Intronic
929454655 2:42057315-42057337 AGACATCCACAGCCTCAGCCAGG - Exonic
930003541 2:46878854-46878876 ACACACACACAGTGTCCGCCTGG + Intergenic
932800204 2:74735063-74735085 AAATATACACAGGCTCAGAAGGG + Intergenic
933146026 2:78853960-78853982 ACACATACACATACTCACAAAGG - Intergenic
933161490 2:79028667-79028689 ACACAAACCCTGTCTGAGCAGGG - Intergenic
933263169 2:80152346-80152368 ACACATGCACAGTCTCACACAGG - Intronic
933294848 2:80477716-80477738 ACACACACACATTCACACCATGG - Intronic
934110908 2:88741418-88741440 ACACATACACACACACACCATGG - Intronic
934907875 2:98221599-98221621 TCACTGACACAGCCTCAGCAGGG - Intronic
934909521 2:98238204-98238226 ACACACACACAGCCTCCGGAGGG - Intronic
935318171 2:101858413-101858435 ACACACACACAAGCTCATCATGG + Intronic
935558592 2:104537928-104537950 AGACATACACACTCACAGCTTGG + Intergenic
936246212 2:110829704-110829726 ACATACACACACACTCAGCAAGG - Intronic
936552937 2:113465390-113465412 ACACTTACACAGTGTTATCATGG - Intronic
936766623 2:115857731-115857753 ACACATACACAGTATAAGGATGG - Intergenic
938608259 2:132919362-132919384 AGACAGACACAGTCTCTGCCAGG - Intronic
938886872 2:135659038-135659060 ACACACACACAGACTCAGGTAGG - Intronic
943488084 2:188514032-188514054 ACACACACACACACTCAGAAGGG - Intronic
944099230 2:196004798-196004820 ACACACACACACTCTTAGCTAGG + Intronic
944426916 2:199593175-199593197 ACACATACTGTGTCTCAGAATGG + Intergenic
944521286 2:200570467-200570489 ACACACACACATTTTCAGAAAGG - Intronic
944647261 2:201792276-201792298 ACACATACACACACACAGGATGG - Intronic
944836660 2:203587116-203587138 ACACACACACACTCACATCAAGG + Intergenic
944891192 2:204118768-204118790 ACACACACACAGTCTCAAACTGG - Intergenic
944914628 2:204345628-204345650 TGACAAACACAGTCTTAGCAAGG + Intergenic
945314860 2:208360475-208360497 GCACAAGCACAGTCTCAGCCGGG - Intronic
945406196 2:209451664-209451686 ACACATACACATACTAAACAGGG + Intronic
946182083 2:217954911-217954933 ACACATACACATGCACAGAAGGG + Intronic
946360909 2:219218883-219218905 GCACGTACGCCGTCTCAGCACGG + Exonic
946391580 2:219419548-219419570 AAAAAGACACAGTCTCGGCAAGG - Intronic
946641073 2:221783936-221783958 GCACATAGACAATCTCAGTAGGG + Intergenic
948563446 2:238868626-238868648 CCACAGACACAGTCACAGCCAGG - Intronic
1169171758 20:3471056-3471078 ACACATACACACACACCGCACGG - Exonic
1169991445 20:11507932-11507954 ACACACACACACACTCACCATGG + Intergenic
1171161827 20:22932727-22932749 TCACATACACTGTCTCAACAGGG - Intergenic
1173883201 20:46434646-46434668 ACACATACACAGTCTTTCCCAGG - Intergenic
1174756031 20:53159236-53159258 ACAAAAACACAGGCTCAGCCTGG - Intronic
1175019863 20:55834242-55834264 ACACATATGGAGACTCAGCAGGG - Intergenic
1175511350 20:59528292-59528314 ACACAGACACAGTCTTACAAGGG + Intergenic
1176514978 21:7777317-7777339 ACACACACACATACTCAGCTGGG - Intergenic
1177736857 21:25101820-25101842 ACACATATACAGACCCAGGAAGG + Intergenic
1178154365 21:29833769-29833791 ACACACACACTCTCTCAACAAGG + Intronic
1178649033 21:34407376-34407398 ACACACACACATACTCAGCTGGG - Intronic
1179049258 21:37874815-37874837 ACACATTCACAATCCAAGCACGG + Intronic
1179250876 21:39670200-39670222 ACACACACACAGTCTGAGTGTGG - Exonic
1179462203 21:41544089-41544111 AGAAATACACAGTTTCAGCCAGG + Intergenic
1181617238 22:24063213-24063235 ACACACACACACCCTCAACATGG - Intronic
1182056489 22:27359458-27359480 ACACAAACACAGTCTATGCCAGG - Intergenic
1182599043 22:31445468-31445490 TCATACACACAGTCACAGCATGG - Intronic
1183216996 22:36487181-36487203 AAACATACATTTTCTCAGCAAGG + Exonic
1184162124 22:42703052-42703074 ACACACACACACACACAGCAGGG - Intronic
1184467852 22:44679407-44679429 ACAAAGACACAGCCTCAGCCAGG + Exonic
949108429 3:228487-228509 ACACACACACACACACAGCAGGG + Intronic
950342054 3:12256224-12256246 ACACATACACACACACACCATGG - Intergenic
950469391 3:13175056-13175078 ACACATACCCAGACCCACCAGGG + Intergenic
950606083 3:14081926-14081948 ACACACACACAGACTTAGTATGG + Intronic
951063197 3:18234453-18234475 AGACATCCAAAGTCTCTGCACGG - Intronic
951996796 3:28739087-28739109 ATGCATACAAAGTCTCAGGAAGG - Intergenic
953329555 3:42041473-42041495 ACAAATACACAAATTCAGCAAGG - Intronic
953358441 3:42274139-42274161 ACACACACACAGTCTCCAAATGG + Intergenic
953716474 3:45320671-45320693 ACACATACACAGTATCCTCTAGG + Intergenic
954850020 3:53592329-53592351 ACACACACACACTCTCAGCCAGG - Intronic
954859133 3:53672747-53672769 ACACACACACAGAGTCATCAAGG - Intronic
955589522 3:60520099-60520121 ACACAAACACAGTCTGGACATGG - Intronic
956062787 3:65364868-65364890 ACACACACCCCTTCTCAGCAAGG - Exonic
956196768 3:66661056-66661078 AAACATAGTCAGTCTGAGCAAGG + Intergenic
956738577 3:72257837-72257859 ACACAGACACTGTCTCAGCTGGG + Intergenic
958567479 3:95833242-95833264 ACACACACACAGACTCATGATGG + Intergenic
959533895 3:107464418-107464440 ACACAGATTCAGTTTCAGCAAGG + Intergenic
959597060 3:108140194-108140216 ACACATACACATTGTTAGGAGGG + Intergenic
960052904 3:113254641-113254663 ACACCCACACACACTCAGCATGG + Intronic
960549236 3:118955250-118955272 ACACATACACACACACACCATGG + Intronic
961212778 3:125138876-125138898 ACACACACACACACTTAGCAGGG + Intronic
961599352 3:128047190-128047212 ACACACACACACACTCACCATGG + Intergenic
961682310 3:128607651-128607673 TCTCATACACACTCTCAGTAGGG - Intergenic
962147953 3:132860892-132860914 ACACACACACAGGCTCACTATGG - Intergenic
962454681 3:135554198-135554220 ACACAAACACAGCCACAGCCAGG + Intergenic
962632123 3:137288854-137288876 AAAAATAAAAAGTCTCAGCAAGG - Intergenic
962748888 3:138418246-138418268 ACACACACACAGTCCTACCATGG + Intergenic
963495139 3:146049178-146049200 GCTCATACACAGTAACAGCATGG + Intergenic
968933076 4:3593818-3593840 ACACATACACAAACACACCAAGG - Intergenic
969049398 4:4362026-4362048 ACACAGACACAGTGTCAGGTGGG + Intronic
969565174 4:7973070-7973092 ACACACACACACACACAGCAAGG - Intronic
970224587 4:13844391-13844413 ACACATAGACAGTAACATCAGGG - Intergenic
970876092 4:20871673-20871695 ACACAGACACAGTTTCCACATGG + Intronic
971779950 4:31020396-31020418 ACACATACACACACATAGCAAGG - Intronic
972626912 4:40808312-40808334 TCACAGACACTGTCTCAGAAGGG - Exonic
972671281 4:41215503-41215525 ACACACACACAGTCCTACCAAGG + Intronic
973588431 4:52415235-52415257 TAACAAACACAGTCTCAGCCAGG + Intergenic
974407910 4:61499371-61499393 ATACATTCACATTCTCTGCATGG + Intronic
974474102 4:62357543-62357565 ACACAAACACAGACTCTGCATGG + Intergenic
975094521 4:70442530-70442552 ACATATGCACAGTAGCAGCATGG + Intronic
975231868 4:71944968-71944990 ACACCTGTACAGTGTCAGCAGGG + Intergenic
977056274 4:92196318-92196340 ACACATACACACACTCGGAATGG + Intergenic
977059504 4:92239661-92239683 ACAAATACACAGAGACAGCAGGG - Intergenic
978727779 4:111990288-111990310 ACACACACACACACACAGCAAGG + Intergenic
979212004 4:118115991-118116013 ACATTTTCACAGTATCAGCATGG - Intronic
979306107 4:119145495-119145517 ACACACACACAGTTTTAGCTGGG - Intronic
980608354 4:135123129-135123151 ACACATGCAGAGGCCCAGCACGG + Intergenic
980672540 4:136028072-136028094 ACACACACACAGACACACCATGG + Intergenic
981166476 4:141565075-141565097 ACACAGACACAGGCTGGGCACGG + Intergenic
981789775 4:148522780-148522802 AGCCATACAGAATCTCAGCATGG + Intergenic
982002149 4:151030991-151031013 ACACTTAAATAGTCTAAGCAAGG + Intergenic
982392244 4:154877378-154877400 ACACCTGTACAGTGTCAGCAAGG - Intergenic
982591185 4:157313700-157313722 ACACACACACATTTTCAGCTAGG - Intronic
984468827 4:180138749-180138771 ACACACACACAGTCACAGAGAGG - Intergenic
985382666 4:189412052-189412074 ACACATACACACACACAACATGG + Intergenic
986623280 5:9698862-9698884 ACACACACACAGAAACAGCATGG - Intronic
987029902 5:13966196-13966218 ACACATACACACACACACCATGG - Intergenic
987105882 5:14638601-14638623 ACACACACACACACTCATCATGG - Intergenic
987613503 5:20241394-20241416 ACACATACACACTCACACCATGG - Intronic
988315451 5:29621163-29621185 ACACACACACACACTCTGCAAGG - Intergenic
988359395 5:30215329-30215351 ACACATATTCACTTTCAGCATGG - Intergenic
989961669 5:50423254-50423276 ACACACACACATACACAGCATGG + Intronic
990563987 5:57010693-57010715 TCACAAACACTGTCTCAGCCAGG + Intergenic
991075352 5:62530316-62530338 ACATATACACAGGTTCCGCAGGG - Intronic
991086811 5:62655289-62655311 ACACACACACAGTCCCCACAGGG - Intergenic
993733680 5:91450947-91450969 ACAGATAGACTGTCTCAGCATGG + Intergenic
994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG + Intergenic
998150661 5:139755630-139755652 ACACACACACACACACAGCAGGG - Intergenic
999442490 5:151613345-151613367 CCACCCACACAGTCTCAGCCTGG + Intergenic
999459468 5:151745477-151745499 ATCCAGCCACAGTCTCAGCAGGG - Intronic
1000495893 5:161984151-161984173 TCTCATACATATTCTCAGCATGG + Intergenic
1001223424 5:169923501-169923523 ACACACACACACTCTTTGCAGGG + Intronic
1003089422 6:3089039-3089061 AAACATACAGAGTCTCTGAAAGG - Intronic
1004679096 6:17875009-17875031 ACACACACACACACACAGCATGG + Intronic
1005655005 6:27927034-27927056 ACACATACACACACACAGCTAGG - Intergenic
1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG + Intergenic
1006487371 6:34354425-34354447 ACACATACACACTCTTGGCCGGG + Intronic
1008585758 6:52947458-52947480 ACACACACACTCTCTCAGCCTGG + Intergenic
1011430276 6:87278974-87278996 AAACATAAAAAATCTCAGCAGGG - Intergenic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1014208800 6:118686807-118686829 TCACATACACACTCTCCACATGG + Intronic
1014588049 6:123225540-123225562 ACACATACACACACACAGAATGG + Intronic
1015112218 6:129606098-129606120 CCACAAACACACTCTCAACAAGG - Intronic
1015449812 6:133353295-133353317 ACACATACACATACACAGCATGG - Intronic
1015651470 6:135466072-135466094 ACACATACAAAGCCACAGCCAGG - Exonic
1016876019 6:148865653-148865675 ACACACACACAATTTCAGCAAGG - Intronic
1017583579 6:155895064-155895086 ACACACACACAGACACATCATGG - Intergenic
1017855526 6:158348048-158348070 AGAAATACAGAATCTCAGCAAGG - Intronic
1018145630 6:160884668-160884690 ACACATACACACTCACATCTTGG - Intergenic
1020181520 7:5926333-5926355 ACACACACACAGGCTTAGGATGG - Exonic
1020301413 7:6798556-6798578 ACACACACACAGGCTTAGGATGG + Exonic
1020552015 7:9619305-9619327 ATACACATACAGTTTCAGCAGGG + Intergenic
1021974165 7:25995554-25995576 ATACAGAAACAGTCTCACCATGG + Intergenic
1022829776 7:34054296-34054318 ACACATACACAATGAAAGCAGGG + Intronic
1023490323 7:40732763-40732785 ACAGACACACTGTTTCAGCATGG - Intronic
1024008317 7:45243707-45243729 ACACATGCACAGTGACAGCGGGG - Intergenic
1024358041 7:48437836-48437858 ACACTTACACAGGCTCAGATAGG - Intronic
1027189810 7:75990009-75990031 AAACAGACAGAGGCTCAGCATGG + Intronic
1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG + Intronic
1028570374 7:92279886-92279908 ACACATACACACACACATCAGGG + Intronic
1029696838 7:102219185-102219207 ACACACACACACCCTCTGCAGGG - Intronic
1030020698 7:105272749-105272771 TCACCTAGACAGTCTCTGCATGG + Intronic
1032182910 7:129696439-129696461 ACACATACACACACACAGAAAGG - Intronic
1034132588 7:148734240-148734262 ACACACACACAGTTGCTGCATGG - Intronic
1034441798 7:151089394-151089416 ACATAAACACAGTGTCAGCTGGG + Intronic
1034774114 7:153808174-153808196 ACACACACACAGTGGCAACAAGG - Intergenic
1035733117 8:1866437-1866459 ACACACACACACACTCTGCAGGG + Intronic
1036120823 8:6015504-6015526 ACACATATACACTGCCAGCAGGG + Intergenic
1036448204 8:8841952-8841974 ACCCCTACTCAGTCTCAGCAAGG + Intronic
1038347824 8:26748279-26748301 ACACACACACATTCTCTCCATGG - Exonic
1038586285 8:28791869-28791891 ACACATCCCATGTCTCAGCATGG + Intronic
1040910517 8:52513606-52513628 AAACATACACATTTTCAGAAAGG - Intergenic
1043614473 8:82108548-82108570 ACACACACACACACACAGCAGGG + Intergenic
1044452117 8:92348878-92348900 ATCCATACAAAGTCTTAGCAAGG + Intergenic
1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG + Intergenic
1045707310 8:104940856-104940878 ACACATACACACACTCACCTAGG - Intronic
1046462212 8:114554816-114554838 CCACATACACAATCTAGGCAAGG - Intergenic
1048440574 8:134456508-134456530 ACACACACACAAACCCAGCAAGG - Intergenic
1048623742 8:136162108-136162130 ACACCAACACATTCTCATCAAGG - Intergenic
1048638318 8:136324393-136324415 TCACATTCACAGTCACAGCATGG + Intergenic
1048711285 8:137214141-137214163 ACACACACACATTCTCTGCTTGG - Intergenic
1048721762 8:137333781-137333803 ACACATACACACTCACAGGCAGG - Intergenic
1048866554 8:138765671-138765693 ACACCTGCACAGTGTCAACAGGG - Intronic
1049423660 8:142527713-142527735 ACACATCCAGGGTCTGAGCATGG + Intronic
1049900061 9:151795-151817 ACACTTACACAGTGTTATCATGG + Intronic
1050054771 9:1640343-1640365 ACACACACACAGAGTCAGTAGGG + Intergenic
1050270809 9:3942697-3942719 ACACAGACTCTGCCTCAGCAGGG + Intronic
1050460692 9:5875123-5875145 ACACACACACACTCACAGTAAGG + Intergenic
1050673703 9:8027618-8027640 ACACAAACAAATTCACAGCAGGG - Intergenic
1052341224 9:27366190-27366212 ACACATTCATAAACTCAGCAGGG - Intronic
1052980682 9:34446603-34446625 ACACATTCACATTCCCACCATGG + Intronic
1053025893 9:34727895-34727917 AGACATACACAGTGGAAGCAGGG - Intronic
1053260872 9:36662537-36662559 AAACATACAGATTCACAGCAGGG - Intronic
1053570050 9:39295502-39295524 ACACACACACACTCTCAGCCGGG - Intergenic
1053743111 9:41162094-41162116 ACACTTACACAGTGTTATCATGG + Intronic
1054091680 9:60854504-60854526 ACACACACACACTCTCAGCCGGG - Intergenic
1054113095 9:61130088-61130110 ACACACACACACTCTCAGCCGGG - Intergenic
1054127098 9:61323514-61323536 ACACACACACACTCTCAGCCGGG + Intergenic
1054348392 9:63991906-63991928 ACACTTACACAGTGTTACCATGG + Intergenic
1054446116 9:65318277-65318299 ACACTTACACAGTGTTATCATGG + Intergenic
1054457055 9:65438159-65438181 ACACATACACAAACACACCAAGG + Intergenic
1054484157 9:65703231-65703253 ACACTTACACAGTGTTACCATGG - Intronic
1054594629 9:67052193-67052215 ACACACACACACTCTTAGCCAGG + Intergenic
1054685232 9:68269195-68269217 ACACTTACACAGTGTTATCATGG - Intronic
1054965965 9:71026846-71026868 ACACACACACAGTCGCAGGTGGG + Intronic
1055395558 9:75870118-75870140 ACACATACACAATCACAAAATGG - Intergenic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1060652859 9:125345081-125345103 TCACATACACAGTTTCCACAGGG - Intronic
1060710122 9:125854026-125854048 ACACATACACATGCACAACATGG + Intronic
1062496746 9:136835511-136835533 ACACCTACACACTGCCAGCATGG - Intronic
1187586969 X:20674050-20674072 ACACACACACACTCTCAGATTGG + Intergenic
1187589304 X:20698991-20699013 ACACATACACACACACACCATGG + Intergenic
1187905801 X:24065322-24065344 ACATATACACAGGCTGGGCATGG + Intronic
1190799779 X:53776946-53776968 ACACATCTACAGGCTGAGCACGG - Intergenic
1191104262 X:56762811-56762833 ACACATACACACACTCACTAGGG + Intergenic
1191863216 X:65682931-65682953 ACAGATAAACAGTCTCTCCAAGG - Intronic
1192083016 X:68066394-68066416 CCACATACACAGCCTCAGAGAGG + Intronic
1192098082 X:68234384-68234406 TCCCATACCCCGTCTCAGCAGGG - Intronic
1192911755 X:75612230-75612252 ACACCAACACAGTCTCACCTAGG - Intergenic
1193386883 X:80883266-80883288 ACACATGGAGAGTCTGAGCAGGG + Intergenic
1194506135 X:94735906-94735928 ACACATACACCCTCTCAAGAAGG - Intergenic
1194925688 X:99820360-99820382 CCACATACACAGTCTCAAGTAGG + Intergenic
1194970695 X:100339898-100339920 ACACATACACACTTTCTGCTGGG - Intronic
1197018314 X:121654858-121654880 GCACAAACACAATCTCAACATGG - Intergenic
1197215690 X:123864625-123864647 ACACACACACACTCTAAGCCGGG - Intronic
1197230470 X:123998464-123998486 ACACATACACACACACGGCAGGG - Intronic
1197571704 X:128157675-128157697 ACACATACACACACACAACATGG - Intergenic
1198559199 X:137830458-137830480 ACACATAGACTGTGTCCGCATGG + Intergenic
1201251787 Y:12066122-12066144 ACACATACACACACACACCATGG + Intergenic
1202246075 Y:22821697-22821719 ACACACACAGAATCTAAGCAGGG + Intergenic
1202399063 Y:24455445-24455467 ACACACACAGAATCTAAGCAGGG + Intergenic
1202471717 Y:25214641-25214663 ACACACACAGAATCTAAGCAGGG - Intergenic