ID: 1087184775

View in Genome Browser
Species Human (GRCh38)
Location 11:95177783-95177805
Sequence TAACACTATGGCCACCCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087184775 Original CRISPR TAACACTATGGCCACCCATG AGG (reversed) Exonic
903308322 1:22430580-22430602 TCCCACTTTGGCCTCCCATGTGG + Intergenic
912776503 1:112509156-112509178 GAACACCATGGCCCCCCAGGGGG + Exonic
922327335 1:224540376-224540398 TAATTCAATAGCCACCCATGCGG + Intronic
1064654193 10:17540240-17540262 TAAAATTATGGCCACCCTAGTGG + Intergenic
1073915164 10:108394679-108394701 TACCACTCTGGCCAGCAATGTGG + Intergenic
1075041002 10:119106584-119106606 TAACACTTTGGGAACCCAGGAGG - Intronic
1087184775 11:95177783-95177805 TAACACTATGGCCACCCATGAGG - Exonic
1091813055 12:3415802-3415824 TAACTCGATGGCAAGCCATGTGG - Intronic
1096524315 12:52201432-52201454 AAATCCCATGGCCACCCATGTGG + Intergenic
1101402500 12:104400727-104400749 TAGCACTATGGCAATCCTTGAGG + Intergenic
1109733786 13:66453620-66453642 AACCACTGTGGACACCCATGGGG + Intronic
1120176864 14:81303707-81303729 TAACCCTATGACAACCCAAGGGG + Intronic
1122145723 14:99687875-99687897 TAACACCATGGCCAGACATGGGG - Intronic
1122691748 14:103534943-103534965 TCCCACTCTGGCCACCCAGGAGG - Exonic
1123926684 15:25119608-25119630 TTACAATATGGCCACACACGTGG - Intergenic
1125243679 15:37607667-37607689 AAACACTTTGGCCATCCCTGAGG - Intergenic
1126108750 15:45163457-45163479 TATCAGTATGGACACCCCTGGGG + Intronic
1130145080 15:81267951-81267973 TAAATATATGGGCACCCATGTGG + Intronic
1139017678 16:62709909-62709931 TAACACTATGGCATAACATGGGG - Intergenic
1147349952 17:39834825-39834847 TAACCCTCAGCCCACCCATGGGG - Intronic
1151918646 17:77137831-77137853 TAACAGTATAACCACCCAAGGGG + Intronic
1152764418 17:82128293-82128315 TAACACTCTTACCACCCTTGTGG + Intronic
1161669944 19:5601270-5601292 TGACACTAAGGCCACCCTGGTGG - Intronic
1161857349 19:6773355-6773377 TAACCCAATGGCCACCCTGGGGG - Intronic
1167812892 19:51850310-51850332 GCAGACTATGGTCACCCATGTGG + Intergenic
926268878 2:11349982-11350004 TAAGACGATTTCCACCCATGTGG + Intergenic
927209462 2:20629933-20629955 CACCACTCTGGCCACCCAGGGGG + Intronic
928554808 2:32412466-32412488 TCTCACTATTGCCACCCAGGCGG - Intronic
931029712 2:58158851-58158873 TAACACTATAGCTACCCCTGAGG + Intronic
937665970 2:124487076-124487098 TAACAGTACATCCACCCATGGGG + Intronic
940833045 2:158489875-158489897 TAGCACTAGGGCCACACTTGAGG - Intronic
941345931 2:164369646-164369668 TAATACCATGGCCACACACGAGG - Intergenic
942567551 2:177281736-177281758 TAACACTTTGGTCAGTCATGGGG + Intronic
947141437 2:227022616-227022638 TGACACTATGGAAACCCACGTGG - Intronic
1168764954 20:375625-375647 AATCACTAGGGACACCCATGTGG + Intronic
1168954408 20:1824798-1824820 TAAAACTGTGGTCAGCCATGGGG + Intergenic
1170084044 20:12509470-12509492 TAACACTATGTCCATCCACAAGG + Intergenic
1172480775 20:35270152-35270174 TGACCCGATGGCCTCCCATGAGG - Intronic
1180230718 21:46425392-46425414 CCACACGATGGCCACCCAGGAGG - Intronic
1184326865 22:43794976-43794998 CAACACTATGGCCACGCATTTGG + Intronic
1184736186 22:46399004-46399026 TAACACTGTGGGAACCCAAGAGG + Intronic
1184792322 22:46707697-46707719 TAACATTAGGGCCACTCTTGGGG - Intronic
951745865 3:25976698-25976720 TAACACTATCAACACCCTTGTGG + Intergenic
957340050 3:78883978-78884000 GCACACTCTGGCCACACATGAGG - Intronic
959131317 3:102359846-102359868 TCACACTATGGCCAAGCAAGAGG - Intronic
969281665 4:6174865-6174887 TCACCCTCTGCCCACCCATGTGG + Intronic
971184504 4:24360548-24360570 TCACACTATGGCCTGTCATGGGG - Intergenic
980855847 4:138438743-138438765 TAGAACTAAGGTCACCCATGTGG + Intergenic
981619790 4:146681682-146681704 TAACACAATCGCCTCCCATCAGG - Intergenic
985297548 4:188451759-188451781 CAACACTATGGGCACACATCAGG + Intergenic
986847718 5:11775394-11775416 TAACACTAAGGACACTCCTGAGG + Intronic
991734938 5:69623166-69623188 TAAGACTCTGTCCACCAATGGGG - Intergenic
991780040 5:70123552-70123574 TAAGACTCTGTCCACCAATGGGG + Intergenic
991811372 5:70478301-70478323 TAAGACTCTGTCCACCAATGGGG - Intergenic
991859327 5:70998982-70999004 TAAGACTCTGTCCACCAATGGGG + Intronic
991872487 5:71123875-71123897 TAAGACTCTGTCCACCAATGGGG + Intergenic
993818330 5:92581432-92581454 AAGCACCATGGGCACCCATGGGG - Intergenic
1001093282 5:168757190-168757212 TAAAACCAGGGCCACCCAGGGGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1004762722 6:18688123-18688145 TCACACTGTGGCTACACATGAGG + Intergenic
1006576696 6:35051665-35051687 TAACACTGTAGACACCAATGAGG - Intronic
1008784445 6:55149313-55149335 TACCACTATGGTCACCCAACAGG + Intronic
1019807991 7:3142751-3142773 CAACACCATGTCCACCAATGGGG + Intronic
1021287224 7:18795491-18795513 TAACACTATGGCATCCCAAGCGG + Intronic
1023558542 7:41448592-41448614 TAATACTATCGCCACCCTAGTGG - Intergenic
1031648976 7:124262179-124262201 TAATACTATCGCCAGCCATAGGG - Intergenic
1037697266 8:21234929-21234951 TAACAGTATGGCTACCTGTGTGG - Intergenic
1040511454 8:48099960-48099982 TCACCCCATGACCACCCATGGGG + Intergenic
1041504728 8:58583676-58583698 TATCACAATTGCCACCCATCGGG - Intronic
1047852005 8:128867063-128867085 TAACACTGTGGCCTCCTTTGAGG - Intergenic
1058846743 9:108968000-108968022 TGACACTATGCCCACCCCAGAGG - Intronic
1199715298 X:150503641-150503663 TAAAGCTCTGTCCACCCATGAGG + Intronic
1200870763 Y:8095573-8095595 TATCACTATGTCCACCAATTAGG - Intergenic
1200918483 Y:8592201-8592223 TAACACAATGGATTCCCATGAGG - Intergenic
1200934069 Y:8723025-8723047 TTACACAATGGCTACCCATGAGG + Intergenic