ID: 1087185315

View in Genome Browser
Species Human (GRCh38)
Location 11:95185928-95185950
Sequence CAGGTTCTTTCTCCATTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087185315 Original CRISPR CAGGTTCTTTCTCCATTAGA AGG (reversed) Intronic
902314226 1:15605586-15605608 CAGTTTCTTTATCCATGAAATGG + Intergenic
903977459 1:27160138-27160160 CAGCTTCTTCCTCCATAAGGGGG + Intronic
904036759 1:27563073-27563095 CAGGTTCTCTGTGCATTAGTGGG - Intronic
904697816 1:32340112-32340134 CATGTTCTTTTTCCCTTTGATGG - Intergenic
905257921 1:36696964-36696986 CAGTTTCTTTATCCGTAAGATGG + Intergenic
907527053 1:55059849-55059871 CAGCTTCCTCCTCCATAAGAGGG + Intronic
907546761 1:55267247-55267269 AAGGCTATTTCTCCATTGGATGG + Intergenic
908633627 1:66138000-66138022 CAGTTTCTTTCTCTATAATATGG - Intronic
915725156 1:158011939-158011961 CAGTTTCTTTCTCCATCTGGAGG + Intronic
916065679 1:161133628-161133650 CAGTTTCTTTCTCGTTTAGGGGG + Intergenic
916383157 1:164235910-164235932 CAGGCTCTTTCTTTATTAGCTGG + Intergenic
921293898 1:213683965-213683987 CAGGGTCTTCTTCCTTTAGATGG - Intergenic
921568739 1:216752824-216752846 CAGTTTCTTCCTCCATAAAATGG + Intronic
922182049 1:223243192-223243214 CAGCTTCTGTCTCCCTGAGAAGG - Intronic
923968355 1:239170080-239170102 TAGATTCTTCCTCCATTACAGGG - Intergenic
1064529295 10:16290916-16290938 CAGGTTCTTTGTCTATCAGTTGG - Intergenic
1065056634 10:21850908-21850930 CTGTTTCTATCTCCATTAAATGG - Intronic
1068170435 10:53386418-53386440 CAGTTTCTTTTTCCACAAGATGG - Intergenic
1069321419 10:67176311-67176333 GAGGCTGTTTCTCCATTACATGG + Intronic
1069888724 10:71639652-71639674 CAGTTTCTTTCTCCAAGAAAAGG + Intronic
1070455123 10:76605890-76605912 CAGATTCTATATCCATTAGAAGG + Intergenic
1072504681 10:96053298-96053320 CAGGTTATTTCTTTATAAGATGG + Intronic
1073165701 10:101448247-101448269 GATGTTTTTTCTCCAATAGAAGG - Intronic
1073582578 10:104681600-104681622 TAGGTTCTTTCTCCATCACTAGG + Intronic
1073903081 10:108245634-108245656 CACGTTCTCTGTCCATGAGATGG - Intergenic
1074862697 10:117524357-117524379 CAGTTTCTTTTTCCATGAAATGG - Intergenic
1074870083 10:117569440-117569462 CATGCTCTTTCTGCCTTAGAGGG - Intergenic
1075584902 10:123650627-123650649 CTGGTGCTTTCTCCAGTGGAAGG - Intergenic
1079533138 11:21479069-21479091 AACCTTCTTTCTCCATTAGTGGG + Intronic
1079950723 11:26800291-26800313 CAGTTTCCTTATCCATTAAATGG - Intergenic
1081327467 11:41762996-41763018 GAGGTTCTTTCTCCATTGTCAGG - Intergenic
1086148660 11:83583520-83583542 CAGCTTCTTTATCCATAATATGG + Intronic
1086363426 11:86083299-86083321 CAGGTTCTTTCTGTTTCAGAAGG + Intergenic
1087185315 11:95185928-95185950 CAGGTTCTTTCTCCATTAGAAGG - Intronic
1087211484 11:95449800-95449822 AATTTTCTGTCTCCATTAGAAGG + Intergenic
1087629870 11:100637390-100637412 CATTTTGTTTCTTCATTAGAAGG - Intergenic
1087967132 11:104430164-104430186 CAGTTTCTTTATCCATTTGTTGG + Intergenic
1088368212 11:109061038-109061060 CTGGTTCTATATCCAGTAGAAGG - Intergenic
1089084856 11:115808349-115808371 CAATTTCTTAATCCATTAGATGG - Intergenic
1089920390 11:122204090-122204112 CAGTTTCTTTGTCCATAAAATGG + Intergenic
1097423688 12:59414573-59414595 CAGGTTCTGTTTCCATAAAAAGG + Intergenic
1101714228 12:107296438-107296460 TAGCTTCTTTATCCATAAGATGG - Intergenic
1102601383 12:114033267-114033289 CAGCTTGTTTATCCATTAAATGG + Intergenic
1102766216 12:115435609-115435631 AAGGTTCCTTGTCCATTACATGG - Intergenic
1103216320 12:119204059-119204081 CAGTTTCTTTATCCATAAAATGG + Intronic
1106504979 13:30363342-30363364 CAGTTTCTTTTTCTATTAAATGG - Intergenic
1106794740 13:33192922-33192944 TAGCTTCTTCCTCCATAAGATGG - Intronic
1109882415 13:68497097-68497119 CACATTCTTTTTCCATTAGATGG - Intergenic
1110696619 13:78498385-78498407 CATGTACTTTCTCCCTTAGATGG + Intergenic
1111538503 13:89637621-89637643 CAAGTTATTTCTGCATAAGATGG + Intergenic
1112905148 13:104408420-104408442 AAAGGGCTTTCTCCATTAGATGG - Intergenic
1113384632 13:109837282-109837304 CATGTTCTTTCCTCATGAGATGG - Intergenic
1116169846 14:41386155-41386177 AAGGTTCTTTCTCCACCAAATGG + Intergenic
1118075819 14:62297685-62297707 CAGGTTATTTCTCCTTTAGGAGG - Intergenic
1120319259 14:82938300-82938322 CAGGTTTTTTCTCTTTAAGACGG + Intergenic
1121827217 14:97020165-97020187 CATTTTCTTTATCCATGAGATGG + Intergenic
1123406334 15:20021288-20021310 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123515664 15:21027936-21027958 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1124021411 15:25928309-25928331 CAGTTTATTTCTCCATTTGTTGG - Intergenic
1124069844 15:26381064-26381086 CAGGGTCTGTCTGCATAAGAGGG + Intergenic
1125384494 15:39122845-39122867 GAGCTTCTTTGCCCATTAGATGG - Intergenic
1127915926 15:63454984-63455006 CAGTTTCTTCATCCATTAAATGG - Intergenic
1130632157 15:85580366-85580388 CCAGTTCTTTCTCCATTTTAGGG - Exonic
1130723254 15:86411123-86411145 CAGGGTTTTTCTCCATTCCAAGG - Intronic
1133481792 16:6177872-6177894 CAAGTTCTTCCTGAATTAGATGG - Intronic
1135016305 16:18927044-18927066 CAGCTTCTTTCACCAGCAGAAGG - Intergenic
1135321928 16:21502864-21502886 CAGCTTCTTTCACCAGCAGAAGG - Intergenic
1135869632 16:26137280-26137302 CTGCTCCTTTCTCCATTACATGG - Exonic
1136333398 16:29595980-29596002 CAGCTTCTTTCACCAGCAGAAGG - Intergenic
1137747327 16:50832112-50832134 CAAGTTCTTTCTCCATGAGGTGG + Intergenic
1138048925 16:53755373-53755395 CATGTTCTTTCTCCCTCAGGAGG - Intronic
1138575718 16:57906225-57906247 CAGTTTCCTTCTCCATAAGATGG + Intronic
1140917916 16:79510117-79510139 CAGTTTCTTCCTCCATAAAATGG + Intergenic
1141011361 16:80403382-80403404 CAGTTTCTTTATCCATAATATGG - Intergenic
1141234176 16:82200079-82200101 CAGCTTCTCTCTCCATAAAATGG + Intergenic
1141295222 16:82761486-82761508 CATGTTCTTTCTACCTCAGAAGG + Intronic
1141421663 16:83921589-83921611 CAGGCTCTTTCTCCTTATGATGG - Exonic
1142056145 16:87997407-87997429 CAGGTTCTGTCACCAATAAATGG + Intronic
1143322401 17:6076622-6076644 CAGGCTCATTGTCCATTAAATGG - Intronic
1144591536 17:16528362-16528384 ACAGTTCTTTCTACATTAGATGG + Intergenic
1148208157 17:45792422-45792444 CAGGTTCTTTCCCCTCTAGAAGG - Intronic
1148247456 17:46043392-46043414 CTGGTTCTATCTCGAGTAGAAGG + Intronic
1149702548 17:58667557-58667579 CAGGTTCTTTATCCATGAAATGG - Intronic
1153876224 18:9374542-9374564 CTGGTACTTTCTCTTTTAGAAGG - Intronic
1158642921 18:59219239-59219261 CAGTTTCTTTCTCTATTCCATGG + Intergenic
1160305255 18:77727712-77727734 AAGGCTATTTCTCCATTACAGGG - Intergenic
1161111361 19:2472480-2472502 CAGTTTCTTTCTCTGTAAGATGG - Intergenic
1161703727 19:5808192-5808214 CAGTTTCTCTTTCCATCAGATGG + Intergenic
1161975565 19:7606314-7606336 CAGGGTCTTTGTCCACTCGAAGG - Exonic
1162000656 19:7742936-7742958 CAGATTCTTCCTCCTTTAGAAGG - Exonic
1164808498 19:31137896-31137918 CAGGTTTTTCCACCATCAGAAGG + Intergenic
1166427543 19:42692939-42692961 CATCTTCTTTCTCCATAATAAGG + Intronic
1166828878 19:45626546-45626568 CAGTTTCTTTCTCCATACCATGG - Intronic
926972488 2:18480726-18480748 CAGGTCCTTTGTACATTAGTGGG - Intergenic
928192012 2:29179546-29179568 CAGATTCTTCTTCCATTATAAGG + Intronic
930344905 2:50167904-50167926 CAGTTTATTTCTCCACTAGAAGG + Intronic
931466028 2:62487615-62487637 TAGCTTCTTTATCCATTAAAGGG - Intergenic
931912869 2:66921238-66921260 CAGATTCTTTCTCCTTTACTAGG + Intergenic
932283784 2:70516087-70516109 GAGGTTCCTTCTTCATTGGAAGG - Intronic
933759660 2:85664964-85664986 GGGGATCTTTCTCCATCAGATGG + Intronic
935848420 2:107192000-107192022 CAGGTGCTTTCTCTTTTGGAAGG - Intergenic
936170563 2:110168517-110168539 CAGGTTTTTTTTCAATTACAAGG + Exonic
937902529 2:127032018-127032040 CATCTTTTTTCTCCATTACAAGG - Intergenic
941766092 2:169298341-169298363 CAGGTTCTTACTCTATAAAATGG - Intronic
943008188 2:182412446-182412468 CAGTTTCTTTATCCATAATATGG + Intronic
944287894 2:197972968-197972990 CAGGTTCTGTATCAATGAGATGG + Intronic
945046202 2:205784154-205784176 CAGTTTCTTTCTCCAGCAGCAGG + Intronic
945120618 2:206453751-206453773 GAGGTTCATTCTCCATCACAGGG + Intronic
945269190 2:207921886-207921908 CATTTTCTTTGTCCATTTGATGG + Intronic
945772856 2:214066743-214066765 CATGTTCCTTTTCCATTATATGG - Intronic
946624726 2:221598799-221598821 CAGGTTCTTCCTCTTTTTGATGG - Intergenic
947497943 2:230652375-230652397 CAGGTTATTTCTCAATAAGATGG + Intergenic
948126566 2:235568408-235568430 CAGTTTCTTTCTCCATAAAACGG - Intronic
948900874 2:240956379-240956401 CGGGTTGTTTCTCCTTTGGAAGG - Intronic
1168805908 20:672235-672257 CTGGTGCTTTCTTCATTTGAGGG + Intronic
1170297631 20:14845910-14845932 CAGGTTCTTGGTCAATTACATGG - Intronic
1172810750 20:37646290-37646312 CAGGTTCCTCCTCTATTAAATGG + Intergenic
1173123883 20:40318932-40318954 CAGGTGCTTTCTTCACAAGATGG + Intergenic
1174181702 20:48679250-48679272 CAGTCTCCTTCTCCATTAAATGG - Intronic
1174244759 20:49169766-49169788 CTGGTTCTTTCCCTATTTGAAGG + Intronic
1175096940 20:56548698-56548720 CAGCTTCTTTCTCCAGCAGCAGG + Intergenic
1177771185 21:25518530-25518552 CAGATTCTTTCTCCACCACATGG - Intergenic
1177859479 21:26436059-26436081 CAGGATTTGTCTCCATTAGAAGG + Intergenic
1178553397 21:33562461-33562483 CAGATTTTATCTCCATAAGAGGG + Intronic
1179182824 21:39060254-39060276 CAGCTTCTTCATCCATTAAATGG - Intergenic
1181934983 22:26431887-26431909 CAGTTTCTTTATCCATGAAATGG - Intronic
1181964782 22:26648627-26648649 CAGGTCTTTTCTCCATTGGCAGG - Intergenic
1183305101 22:37078658-37078680 CAGATTCCTGCTCCTTTAGAAGG + Intronic
949868082 3:8563174-8563196 CCTGTTCTTTCTACACTAGATGG - Intronic
950680463 3:14581597-14581619 CATGTTCTTTGTCCACTGGAAGG + Intergenic
951525775 3:23651262-23651284 CATGTTTTTTCTCCAGGAGAGGG - Intergenic
951936542 3:28028969-28028991 GAGGTTCTGTCACCATTAGCAGG - Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
955133009 3:56189207-56189229 CTGTTTCTTTCTTCATAAGACGG + Intronic
955169194 3:56546673-56546695 CAGTTTCTTTCCCCATAAAATGG - Intergenic
955170670 3:56561838-56561860 CAGGAGCTTACCCCATTAGAAGG - Intronic
955442804 3:58975029-58975051 CAGTTTCTTTATCCAGTAGGTGG + Intronic
956245974 3:67183607-67183629 CAGTTCCTTTCTCCATTGAATGG + Intergenic
956453156 3:69393854-69393876 CAGTTTCTTTATCCATGAAATGG - Intronic
956576315 3:70756560-70756582 CAGGCTCTTACTTCAATAGAGGG - Intergenic
956704788 3:71990121-71990143 CAGTTTCTTCCTCCATAAAATGG - Intergenic
956783062 3:72619622-72619644 CAGTTTCTTTTTCCATAAAATGG - Intergenic
957261420 3:77906799-77906821 CATATTCTTTCTACATAAGAGGG - Intergenic
958472513 3:94538533-94538555 CAGATTCACTCTCCTTTAGAAGG - Intergenic
959501408 3:107109963-107109985 CAGGTCATTTCTGCATAAGATGG + Intergenic
960852092 3:122066238-122066260 CAGTTTCTTTGTCACTTAGAAGG + Intronic
961074455 3:123968750-123968772 CAGTTTATTTCTCCATTTGTTGG - Exonic
961091472 3:124116276-124116298 CAAGTTCTTTTTCCAGTACAAGG - Intronic
961309232 3:125983697-125983719 CAGTTTATTTCTCCATTTGTTGG + Intergenic
962421889 3:135236157-135236179 CAGGGTCGTTCTCCCTTTGAAGG + Intronic
962677551 3:137768123-137768145 CAGGTTCTTTCTCCAGCTGGGGG - Intergenic
964832485 3:160900220-160900242 CAGGTTTCTACTCCATCAGATGG + Intronic
965141034 3:164835031-164835053 CAGGTTCTCTCTTATTTAGATGG + Intergenic
966671224 3:182528332-182528354 CTGGTTGTTTCTCCTTTAGCTGG - Intergenic
967020355 3:185517115-185517137 GAGGATCTTTCCCCCTTAGATGG + Exonic
967089079 3:186119682-186119704 CAGGGTCTGTCTCCATCACAGGG + Intronic
970203475 4:13632759-13632781 CAGGTACTTTCTCCCTTAACAGG + Intergenic
972424816 4:38922343-38922365 CAGCTTCTTTATCCATAAAATGG - Intronic
974022315 4:56702832-56702854 CAGCTTCCTTATCCATTAAAAGG + Intergenic
974411589 4:61548205-61548227 CATGTTTTTTCTCCATTTGTAGG + Intronic
975228888 4:71907747-71907769 CAGCATCTTTCTCCATTTTATGG + Intergenic
977169557 4:93743831-93743853 CAGCATCTTCCTCCAATAGAGGG - Intronic
977494827 4:97761717-97761739 CTTGTTCTTTCTTAATTAGAGGG - Intronic
978264971 4:106812759-106812781 CAGGTACTTTCTCCATTTCTAGG + Intergenic
983938191 4:173517518-173517540 CCGGTTCTTTCACAATCAGATGG + Intergenic
985759875 5:1742937-1742959 CAGATTCTTCCTCCCTTAGGTGG + Intergenic
987501125 5:18710524-18710546 CAGGTTCTTTCTGCACTCAAAGG - Intergenic
988812071 5:34795305-34795327 CTATTACTTTCTCCATTAGATGG - Intronic
988987652 5:36636652-36636674 CTGGTTCTTTCTGCATTTAATGG - Intronic
990254361 5:53950528-53950550 CAGATTACTTCTCCATTTGAGGG + Intronic
990387172 5:55277036-55277058 CAGGTTCTTTCCCTAGAAGATGG - Intronic
991144726 5:63286978-63287000 CAGGTGCTCTCTAGATTAGAAGG + Intergenic
991291119 5:65034943-65034965 AAGGTCCTTTATCCCTTAGAGGG + Intergenic
992218671 5:74550006-74550028 CAGGTTCTTTATCTATAAAATGG - Intergenic
993541502 5:89158531-89158553 CATATTGCTTCTCCATTAGAGGG - Intergenic
995039293 5:107570104-107570126 CAGTTTCTTTCACCATTAGGAGG - Intronic
998181530 5:139949141-139949163 CAGCTTCTTTCTCCCTTAAAGGG - Intronic
998297731 5:140987558-140987580 CAGTTTCTTTCTCTATAAAATGG + Intronic
998858254 5:146416679-146416701 AAGCTTCTTTCTCCATTTAATGG + Intergenic
999212187 5:149899515-149899537 GAGGTTCTTTCTACAAGAGAAGG + Exonic
999471055 5:151855849-151855871 CTCTTTCCTTCTCCATTAGAAGG + Intronic
1001598557 5:172914400-172914422 CAGTTTCTTTCTCTGTAAGATGG - Intronic
1001781003 5:174369080-174369102 CAGTTTCTTCATCTATTAGATGG - Intergenic
1002304013 5:178272942-178272964 CAGTTTCCTTCTCCGTAAGATGG - Intronic
1005625068 6:27654607-27654629 TCTGTTCTTTCTCCATTAAATGG - Intergenic
1007148891 6:39667866-39667888 CAGGCTCTATCTCCATTACTGGG - Intronic
1007998504 6:46334483-46334505 CAGGTTCACTCTCCTTTATAGGG - Intronic
1011247881 6:85339038-85339060 CAGGTTGGTTATTCATTAGATGG + Intergenic
1015886477 6:137923482-137923504 CTGGTTCTTTCTCTACTGGAAGG - Intergenic
1016473465 6:144400055-144400077 AATGACCTTTCTCCATTAGAGGG - Intronic
1017805733 6:157943885-157943907 CAGGTTAGCTCCCCATTAGATGG + Exonic
1018309886 6:162496929-162496951 CAGCCTCTTTCTTCATTATAAGG - Intronic
1019204264 6:170345749-170345771 CAGGTTCAGACTCCATGAGATGG - Intronic
1020486054 7:8722058-8722080 CAGGACCTTTATTCATTAGAGGG + Intronic
1023212387 7:37821337-37821359 CAGGTTCTATGTGCAATAGATGG + Intronic
1028860723 7:95647069-95647091 CATTTTCTTTATCCATTTGATGG + Intergenic
1030221511 7:107103895-107103917 CAGGTTCTGTCTCAATTTAAAGG + Intronic
1032361402 7:131258817-131258839 CAGGTTGTATCTCCTCTAGATGG - Intronic
1032577130 7:133067082-133067104 CAGTTTCTTTCTACATAAAATGG + Intronic
1036657035 8:10683395-10683417 CAGGTTCTTCCTCCATCAGCTGG + Intronic
1037435573 8:18859522-18859544 CAGCATCTTTTTCCAATAGATGG + Intronic
1038684179 8:29701314-29701336 CAGGCTCCTTCTCCAATAGGTGG - Intergenic
1039578991 8:38648692-38648714 AAGTTTCTTCTTCCATTAGAAGG + Intergenic
1039733789 8:40307962-40307984 CAGTTTCTTTCTCCCTTGGTTGG + Intergenic
1043167757 8:76925676-76925698 CATCTTCTTCCTCCATTAGATGG - Intergenic
1043918507 8:85952634-85952656 CAGCTTCTTTCTCTCTTAAATGG - Intergenic
1044867055 8:96581860-96581882 CAGGTTCTTGCCCAATAAGAGGG - Intronic
1045586201 8:103539955-103539977 CAGGTTCTTGCTCTGTTAGGTGG - Intronic
1045853431 8:106732530-106732552 CATGTTCTTTATCCAGTTGAGGG + Intronic
1045861872 8:106822597-106822619 CAGGTTCTGTTGGCATTAGAGGG + Intergenic
1046254179 8:111674561-111674583 CAGGTTCTTTGCAGATTAGATGG + Intergenic
1050320524 9:4447696-4447718 GAAATTTTTTCTCCATTAGATGG + Intergenic
1052415869 9:28176444-28176466 CACATATTTTCTCCATTAGATGG + Intronic
1052622235 9:30928164-30928186 CAGGCTTGTTCTCTATTAGATGG + Intergenic
1057757927 9:97852450-97852472 CAGGATCTGTCTCTATTTGATGG - Intergenic
1060894155 9:127206974-127206996 CAGGTTCTTTATCTATAAGGTGG + Intronic
1188333601 X:28900365-28900387 TATGTTCTCTTTCCATTAGAGGG - Intronic
1189850754 X:45173968-45173990 CAGGTCCTTTCTGCGGTAGAAGG + Intronic
1190199625 X:48349733-48349755 CAGGTTCCTAGTCCATAAGATGG - Intronic
1190204274 X:48389714-48389736 CAGGTTCCTAGTCCATAAGATGG + Intronic
1190206262 X:48405689-48405711 CAGGTTCCTAGTCCATAAGATGG - Intronic
1192826839 X:74705563-74705585 CAGATTCTTTCTCCACTGCATGG + Intergenic
1196292763 X:113962744-113962766 CAGTTTCTTTCTTAATTTGATGG - Intergenic
1196844307 X:119886478-119886500 CAGGTTCTGTTACCAGTAGAGGG - Intergenic
1197177249 X:123499475-123499497 CTGGTTCTTTCTCAATTGTAAGG + Intergenic
1197618683 X:128722272-128722294 CAGGTTCTTTGTCCAACATAGGG + Intergenic
1198993097 X:142538857-142538879 CAGGCTCTTACTCCATCAAAGGG - Intergenic
1199092730 X:143711213-143711235 GAGGTTTTTTGTCCATTTGAGGG + Intergenic
1199358093 X:146884604-146884626 CAGGGTCTTTCTCTACTACAAGG + Intergenic
1201400772 Y:13601782-13601804 CAGGCTGTTTCTCCATTTAAAGG - Intergenic