ID: 1087185864

View in Genome Browser
Species Human (GRCh38)
Location 11:95194272-95194294
Sequence CTCAGGTTACCTAGTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087185864 Original CRISPR CTCAGGTTACCTAGTAATGG GGG (reversed) Intronic
905358538 1:37402181-37402203 CTCTGGGTACCTAGTGCTGGTGG + Intergenic
907132300 1:52107795-52107817 CTCAGCCTCCCGAGTAATGGGGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
919134974 1:193496528-193496550 ATCAGGTTGCCTGGGAATGGGGG - Intergenic
920187822 1:204172608-204172630 CTCTGTTGACCTAGTAAGGGTGG + Intergenic
1062963488 10:1590900-1590922 CTCAGGTTACTCAGTAAAAGGGG + Intronic
1065763601 10:29006514-29006536 CTCTGGTTACCAACTAAGGGAGG - Intergenic
1070200054 10:74195791-74195813 CTCAGCTTCCCTAGTAACTGGGG + Intronic
1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1087885698 11:103479805-103479827 TTCAGGTGACATAATAATGGAGG + Intronic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1098039499 12:66339807-66339829 ATCAGGTTACCTAGGGATGGGGG - Exonic
1100024511 12:90111546-90111568 CTCAGGTTACTCACTAATGTAGG - Intergenic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1106597399 13:31158085-31158107 TTCAGGTTACTTAGTAATTAAGG - Intronic
1106755951 13:32822694-32822716 CCAAGGTTACTTAGTAAAGGTGG + Intergenic
1112716824 13:102196465-102196487 CTCAGTTTGCCTAGTACTGAAGG + Intronic
1114376407 14:22151368-22151390 CTCAATTTACCTGGTAATTGAGG - Intergenic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1117010451 14:51465448-51465470 CTATGGTTACCTAGAGATGGCGG - Intergenic
1119129107 14:72155337-72155359 CTCAGGGTACTCAGGAATGGTGG - Intronic
1123057151 14:105575916-105575938 CTGAGGTTACATGGTGATGGGGG + Intergenic
1123081093 14:105695975-105695997 CTGAGGTTACATGGTGATGGGGG - Intergenic
1124812240 15:32952805-32952827 CTCAGGTTATTTAGTAATAAGGG + Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1131134440 15:89922822-89922844 CTCAGCCTCCCCAGTAATGGTGG + Intergenic
1134879505 16:17733055-17733077 CAAAGGGTACTTAGTAATGGTGG + Intergenic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1139409828 16:66750773-66750795 CTCAGGTAACCTAGCAGTGAGGG + Intronic
1143374246 17:6457982-6458004 CTCAGGTTAAGTAATAATGAAGG + Intronic
1148917587 17:50995524-50995546 CATTGGTTACCTAATAATGGTGG + Exonic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
1167701549 19:51050367-51050389 ACCTGGTTACCTATTAATGGGGG - Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925662268 2:6214747-6214769 CTGAGATCACCTAGCAATGGGGG - Intergenic
930910556 2:56624259-56624281 CTCTGGTGACTAAGTAATGGAGG - Intergenic
933110050 2:78386567-78386589 CTCAGGTAAACTAGTAAAGAGGG - Intergenic
937116243 2:119406967-119406989 CTCAGTTTACCCAGTGATGGGGG - Intergenic
938421802 2:131152581-131152603 CTCATTTTACCTGGTATTGGGGG + Intronic
945335069 2:208582308-208582330 CTTAGATTTCCTAGTAAAGGAGG + Intronic
1176344266 21:5727444-5727466 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176351080 21:5848028-5848050 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG + Intergenic
1176538587 21:8125513-8125535 GTCAGGTTACCTACAAATGGAGG - Intergenic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1203243533 22_KI270733v1_random:41868-41890 GTCAGGTTACCTACAAATGGAGG - Intergenic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
950323092 3:12076512-12076534 ATCATGTTATCTAGTAATGACGG - Intronic
960111845 3:113852515-113852537 CTAAGGGTACCTAGCAATGCTGG + Intronic
960213544 3:115000826-115000848 CTCTGCTGACCTAGTAGTGGGGG - Intronic
963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG + Intronic
963271714 3:143291619-143291641 CTTAAAATACCTAGTAATGGAGG + Intronic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG + Intronic
972426118 4:38934617-38934639 ATCTGATTACCTAGTAATGTAGG - Intronic
973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG + Intergenic
977767184 4:100812906-100812928 CTCTGGTTAAATAGTCATGGAGG + Intronic
986542823 5:8865079-8865101 ATCAGTTCACCTAGTAATTGGGG - Intergenic
987488093 5:18545436-18545458 CTAAATTTACCTAGTAATTGGGG + Intergenic
990252473 5:53930332-53930354 CTCAGGTGACCAAGAAATGTTGG - Intronic
996131856 5:119791171-119791193 CTCAGTTTACCTGGTAATTGGGG + Intergenic
996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG + Intergenic
1004218453 6:13724144-13724166 ATCAGGTTTCCTAGAAACGGAGG + Intergenic
1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1015599909 6:134902027-134902049 CTCAGGTCACATAAGAATGGAGG - Intergenic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1016596442 6:145807440-145807462 CTCAAGTTCCCTAGTATTGTTGG + Intronic
1023115001 7:36854171-36854193 CTATGGTGACCTAGCAATGGTGG + Intergenic
1026204129 7:68240800-68240822 CTCAGTGTACTTTGTAATGGGGG - Intergenic
1033631927 7:143166812-143166834 CTAAGATTTCATAGTAATGGTGG - Intergenic
1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG + Intergenic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1052169739 9:25378021-25378043 ATCAGGTTAGCTAGGACTGGTGG - Intergenic
1052460908 9:28761780-28761802 CTAACTTTACCTAGTAATTGGGG - Intergenic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1058156004 9:101515535-101515557 CTCAGTTTACATGGTAATGCAGG + Intronic
1203459861 Un_GL000220v1:24951-24973 GTCAGGTTACCTACAAATGGAGG - Intergenic
1189577000 X:42364680-42364702 CTCAGGACCCCTAGTAATAGTGG - Intergenic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1196332806 X:114492068-114492090 CTCAGCCTCCCAAGTAATGGGGG - Intergenic
1199038899 X:143086675-143086697 TTCAGGTTAGCTAGTAGAGGAGG + Intergenic