ID: 1087193392

View in Genome Browser
Species Human (GRCh38)
Location 11:95280306-95280328
Sequence GATTGCACAAAATTCAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087193389_1087193392 25 Left 1087193389 11:95280258-95280280 CCACTTGAGTTAACACATTTAAA No data
Right 1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG No data
1087193388_1087193392 26 Left 1087193388 11:95280257-95280279 CCCACTTGAGTTAACACATTTAA No data
Right 1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087193392 Original CRISPR GATTGCACAAAATTCAAGAT GGG Intergenic
No off target data available for this crispr