ID: 1087194018

View in Genome Browser
Species Human (GRCh38)
Location 11:95286448-95286470
Sequence CTTTATATGCTAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087194013_1087194018 27 Left 1087194013 11:95286398-95286420 CCTCAGTTAAAACGACACTGAGC No data
Right 1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG No data
1087194014_1087194018 5 Left 1087194014 11:95286420-95286442 CCTATTAATTGCAAAGTAATAAC No data
Right 1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087194018 Original CRISPR CTTTATATGCTAAGGGAAGA AGG Intergenic
No off target data available for this crispr