ID: 1087194075

View in Genome Browser
Species Human (GRCh38)
Location 11:95287141-95287163
Sequence GTTCTAAGAAGTTTAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087194075_1087194076 -4 Left 1087194075 11:95287141-95287163 CCACTTTTTAAACTTCTTAGAAC No data
Right 1087194076 11:95287160-95287182 GAACTTTTAATTTCCTGTTTTGG No data
1087194075_1087194077 1 Left 1087194075 11:95287141-95287163 CCACTTTTTAAACTTCTTAGAAC No data
Right 1087194077 11:95287165-95287187 TTTAATTTCCTGTTTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087194075 Original CRISPR GTTCTAAGAAGTTTAAAAAG TGG (reversed) Intergenic