ID: 1087194077

View in Genome Browser
Species Human (GRCh38)
Location 11:95287165-95287187
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087194073_1087194077 25 Left 1087194073 11:95287117-95287139 CCGCTGTATTCAGCATATTCCTG No data
Right 1087194077 11:95287165-95287187 TTTAATTTCCTGTTTTGGACTGG No data
1087194074_1087194077 6 Left 1087194074 11:95287136-95287158 CCTGTCCACTTTTTAAACTTCTT No data
Right 1087194077 11:95287165-95287187 TTTAATTTCCTGTTTTGGACTGG No data
1087194075_1087194077 1 Left 1087194075 11:95287141-95287163 CCACTTTTTAAACTTCTTAGAAC No data
Right 1087194077 11:95287165-95287187 TTTAATTTCCTGTTTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087194077 Original CRISPR TTTAATTTCCTGTTTTGGAC TGG Intergenic
No off target data available for this crispr