ID: 1087200415

View in Genome Browser
Species Human (GRCh38)
Location 11:95339097-95339119
Sequence AAAGGATCTAAAGATGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087200412_1087200415 -7 Left 1087200412 11:95339081-95339103 CCACCCATTGGGTTGAAAAGGAT No data
Right 1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG No data
1087200406_1087200415 24 Left 1087200406 11:95339050-95339072 CCGGCAAACTGTAGAGGTTGCAG No data
Right 1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG No data
1087200413_1087200415 -10 Left 1087200413 11:95339084-95339106 CCCATTGGGTTGAAAAGGATCTA No data
Right 1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG No data
1087200405_1087200415 25 Left 1087200405 11:95339049-95339071 CCCGGCAAACTGTAGAGGTTGCA No data
Right 1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG No data
1087200411_1087200415 -6 Left 1087200411 11:95339080-95339102 CCCACCCATTGGGTTGAAAAGGA No data
Right 1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087200415 Original CRISPR AAAGGATCTAAAGATGCTGA AGG Intergenic
No off target data available for this crispr