ID: 1087200486

View in Genome Browser
Species Human (GRCh38)
Location 11:95339710-95339732
Sequence TCAGCAAGGTAATTGCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087200486_1087200489 30 Left 1087200486 11:95339710-95339732 CCTATTGGCAATTACCTTGCTGA No data
Right 1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087200486 Original CRISPR TCAGCAAGGTAATTGCCAAT AGG (reversed) Intergenic
No off target data available for this crispr