ID: 1087200488

View in Genome Browser
Species Human (GRCh38)
Location 11:95339745-95339767
Sequence AGGAGCTAAAAATACAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087200488_1087200489 -5 Left 1087200488 11:95339745-95339767 CCTCTTCTGTATTTTTAGCTCCT No data
Right 1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087200488 Original CRISPR AGGAGCTAAAAATACAGAAG AGG (reversed) Intergenic
No off target data available for this crispr