ID: 1087200489

View in Genome Browser
Species Human (GRCh38)
Location 11:95339763-95339785
Sequence CTCCTTATGAAACTTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087200488_1087200489 -5 Left 1087200488 11:95339745-95339767 CCTCTTCTGTATTTTTAGCTCCT No data
Right 1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG No data
1087200486_1087200489 30 Left 1087200486 11:95339710-95339732 CCTATTGGCAATTACCTTGCTGA No data
Right 1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG No data
1087200487_1087200489 16 Left 1087200487 11:95339724-95339746 CCTTGCTGAGATCATTGTTTTCC No data
Right 1087200489 11:95339763-95339785 CTCCTTATGAAACTTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087200489 Original CRISPR CTCCTTATGAAACTTGTAAC AGG Intergenic
No off target data available for this crispr