ID: 1087202174

View in Genome Browser
Species Human (GRCh38)
Location 11:95356850-95356872
Sequence CCTCTAGGAATGCAGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087202174_1087202180 19 Left 1087202174 11:95356850-95356872 CCATGTACCTGCATTCCTAGAGG No data
Right 1087202180 11:95356892-95356914 GTTTACCCCAAGGCTATAACAGG No data
1087202174_1087202178 9 Left 1087202174 11:95356850-95356872 CCATGTACCTGCATTCCTAGAGG No data
Right 1087202178 11:95356882-95356904 AGAGCCAACAGTTTACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087202174 Original CRISPR CCTCTAGGAATGCAGGTACA TGG (reversed) Intergenic
No off target data available for this crispr