ID: 1087205716

View in Genome Browser
Species Human (GRCh38)
Location 11:95391859-95391881
Sequence GAGATTATTCTCCAGCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087205716_1087205723 20 Left 1087205716 11:95391859-95391881 CCTTAAAGCTGGAGAATAATCTC No data
Right 1087205723 11:95391902-95391924 ACCTGAGCACACTGATATGGGGG No data
1087205716_1087205722 19 Left 1087205716 11:95391859-95391881 CCTTAAAGCTGGAGAATAATCTC No data
Right 1087205722 11:95391901-95391923 AACCTGAGCACACTGATATGGGG No data
1087205716_1087205720 17 Left 1087205716 11:95391859-95391881 CCTTAAAGCTGGAGAATAATCTC No data
Right 1087205720 11:95391899-95391921 ACAACCTGAGCACACTGATATGG No data
1087205716_1087205721 18 Left 1087205716 11:95391859-95391881 CCTTAAAGCTGGAGAATAATCTC No data
Right 1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087205716 Original CRISPR GAGATTATTCTCCAGCTTTA AGG (reversed) Intergenic
No off target data available for this crispr