ID: 1087205717

View in Genome Browser
Species Human (GRCh38)
Location 11:95391881-95391903
Sequence GTTGTGGGACATAGAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087205717_1087205726 12 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205726 11:95391916-95391938 ATATGGGGGTTTGACCATCAGGG No data
1087205717_1087205720 -5 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205720 11:95391899-95391921 ACAACCTGAGCACACTGATATGG No data
1087205717_1087205725 11 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205725 11:95391915-95391937 GATATGGGGGTTTGACCATCAGG No data
1087205717_1087205721 -4 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG No data
1087205717_1087205723 -2 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205723 11:95391902-95391924 ACCTGAGCACACTGATATGGGGG No data
1087205717_1087205722 -3 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205722 11:95391901-95391923 AACCTGAGCACACTGATATGGGG No data
1087205717_1087205727 18 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205727 11:95391922-95391944 GGGTTTGACCATCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087205717 Original CRISPR GTTGTGGGACATAGAATCAA AGG (reversed) Intergenic
No off target data available for this crispr