ID: 1087205721

View in Genome Browser
Species Human (GRCh38)
Location 11:95391900-95391922
Sequence CAACCTGAGCACACTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087205717_1087205721 -4 Left 1087205717 11:95391881-95391903 CCTTTGATTCTATGTCCCACAAC No data
Right 1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG No data
1087205716_1087205721 18 Left 1087205716 11:95391859-95391881 CCTTAAAGCTGGAGAATAATCTC No data
Right 1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087205721 Original CRISPR CAACCTGAGCACACTGATAT GGG Intergenic
No off target data available for this crispr