ID: 1087209086

View in Genome Browser
Species Human (GRCh38)
Location 11:95427945-95427967
Sequence CAGGCAGATGCCACTATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087209086_1087209096 11 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209096 11:95427979-95428001 ACCTGGGAGGCTGAAATGGGAGG No data
1087209086_1087209095 8 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209095 11:95427976-95427998 GCTACCTGGGAGGCTGAAATGGG No data
1087209086_1087209088 -6 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209088 11:95427962-95427984 TGCCTGTGGTCCCAGCTACCTGG 0: 138
1: 4455
2: 43905
3: 143601
4: 148918
1087209086_1087209094 7 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209094 11:95427975-95427997 AGCTACCTGGGAGGCTGAAATGG 0: 4
1: 308
2: 4362
3: 21125
4: 36391
1087209086_1087209091 -2 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209091 11:95427966-95427988 TGTGGTCCCAGCTACCTGGGAGG 0: 216
1: 6534
2: 58143
3: 172797
4: 226844
1087209086_1087209089 -5 Left 1087209086 11:95427945-95427967 CCAAGAATAGTGGCATCTGCCTG No data
Right 1087209089 11:95427963-95427985 GCCTGTGGTCCCAGCTACCTGGG 0: 126
1: 4334
2: 47370
3: 178564
4: 259633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087209086 Original CRISPR CAGGCAGATGCCACTATTCT TGG (reversed) Intergenic
No off target data available for this crispr