ID: 1087211109

View in Genome Browser
Species Human (GRCh38)
Location 11:95447063-95447085
Sequence CATCAGAGGGAGGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087211109_1087211117 2 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211117 11:95447088-95447110 CATCGGCACCCAAAGCCCGGAGG No data
1087211109_1087211127 25 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211127 11:95447111-95447133 GGACCAAGGCAGCAGAGGGCAGG No data
1087211109_1087211122 11 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211122 11:95447097-95447119 CCAAAGCCCGGAGGGGACCAAGG No data
1087211109_1087211116 -1 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211116 11:95447085-95447107 GCTCATCGGCACCCAAAGCCCGG No data
1087211109_1087211119 4 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211119 11:95447090-95447112 TCGGCACCCAAAGCCCGGAGGGG No data
1087211109_1087211126 21 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211126 11:95447107-95447129 GAGGGGACCAAGGCAGCAGAGGG No data
1087211109_1087211118 3 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211118 11:95447089-95447111 ATCGGCACCCAAAGCCCGGAGGG No data
1087211109_1087211125 20 Left 1087211109 11:95447063-95447085 CCCACCTCGGCCTCCCTCTGATG No data
Right 1087211125 11:95447106-95447128 GGAGGGGACCAAGGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087211109 Original CRISPR CATCAGAGGGAGGCCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr