ID: 1087212964

View in Genome Browser
Species Human (GRCh38)
Location 11:95461813-95461835
Sequence GGACCCTGGTTTACTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087212964_1087212969 -1 Left 1087212964 11:95461813-95461835 CCTGGTGTAGTAAACCAGGGTCC No data
Right 1087212969 11:95461835-95461857 CCTTCTTACCTTGCTGAGGCAGG No data
1087212964_1087212966 -5 Left 1087212964 11:95461813-95461835 CCTGGTGTAGTAAACCAGGGTCC No data
Right 1087212966 11:95461831-95461853 GGTCCCTTCTTACCTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087212964 Original CRISPR GGACCCTGGTTTACTACACC AGG (reversed) Intergenic
No off target data available for this crispr