ID: 1087215842

View in Genome Browser
Species Human (GRCh38)
Location 11:95492860-95492882
Sequence CTTATTTGATAGTGTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087215838_1087215842 24 Left 1087215838 11:95492813-95492835 CCATTTTCCTAATCAAGATTTTC No data
Right 1087215842 11:95492860-95492882 CTTATTTGATAGTGTTGTTCAGG No data
1087215839_1087215842 17 Left 1087215839 11:95492820-95492842 CCTAATCAAGATTTTCCTATGTT No data
Right 1087215842 11:95492860-95492882 CTTATTTGATAGTGTTGTTCAGG No data
1087215840_1087215842 2 Left 1087215840 11:95492835-95492857 CCTATGTTGAGCATCTTTTCAGG No data
Right 1087215842 11:95492860-95492882 CTTATTTGATAGTGTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087215842 Original CRISPR CTTATTTGATAGTGTTGTTC AGG Intergenic
No off target data available for this crispr