ID: 1087216518

View in Genome Browser
Species Human (GRCh38)
Location 11:95501235-95501257
Sequence CAGCATGTTCACCCTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087216518_1087216521 26 Left 1087216518 11:95501235-95501257 CCATAATGAGGGTGAACATGCTG No data
Right 1087216521 11:95501284-95501306 ACAATGAGACTTTGCTTAAAAGG No data
1087216518_1087216519 -8 Left 1087216518 11:95501235-95501257 CCATAATGAGGGTGAACATGCTG No data
Right 1087216519 11:95501250-95501272 ACATGCTGAAGAACCGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087216518 Original CRISPR CAGCATGTTCACCCTCATTA TGG (reversed) Intergenic
No off target data available for this crispr